Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DTL cdna clone

DTL cDNA Clone

Gene Names
DTL; CDT2; RAMP; DCAF2; L2DTL
Synonyms
DTL; DTL cDNA Clone; DTL cdna clone
Ordering
For Research Use Only!
Sequence
atgctcttcaattcggtgctccgccagccccagcttggcgtcctgagaaatggatggtcttcacaataccctcttcaatcccttctgactggttatcagtgcagtggtaatgatgaacacacttcttatggagaaacaggagtcccagttcctccttttggatgtaccttctcttctgctcccaatatggaacatgtactagcagttgccaatgaagaaggctttgttcgattgtataacacagaatcacaaagtttcagaaagaagtgcttcaaagaatggatggctcactggaatgccgtctttgacctggcctgggttcctggtgaacttaaacttgttacagcagcaggtgatcaaacagccaaattttgggacgtaaaagctggtgagctgattggaacatgcaaaggtcatcaatgcagcctcaagtcagttgccttttctaagtttgagaaagctgtattctgtacgggtggaagagatggcaacattatggtctgggataccaggtgcaacaaaaaagatgggttttataggcaagtgaatcaaatcagtggagctcacaatacctcagacaagcaaaccccttcaaaacccaagaagaaacagaattcaaaaggacttgctccttctgtggatttccagcaaagtgttactgtggtcctctttcaagacgagaataccttagtctcagcaggagctgtggatgggataatcaaagtatgggatttacgtaagaattatactgcttatcgacaagaacccatagcatccaagtctttcctgtacccaggtagcagcactcgaaaacttggatattcaagtctgattttggattccactggctctactttatttgctaattgcacagacgataacatctacatgtttaatatgactgggttgaagacttctccagtggctattttcaatggacaccagaactctaccttttatgtaaaatccagccttagtccagatgaccagtttttagtcagtggctcaagtgatgaagctgcctacatatggaaggtctccacaccctggcaacctcctactgtgctcctgggtcattctcaagaggtcacgtctgtgtgctggtgtccatctgacttcacaaagattgctacctgttctgatgacaatacactaaaaatctggcgcttgaatagaggcttagaggagaaaccaggaggtgataaactttccacggtgggttgggcctctcagaagaaaaaagagtcaagacctggcctagtaacagtaacgagtagccagagtactcctgccaaagcccccagggtaaagtgcaatccatccaattcttccccgtcatccgcagcttgtgccccaagctgtgctggagacctccctcttccttcaaatactcctacgttctctattaaaacctctcctgccaaggcccggtctcccatcaacagaagaggctctgtctcctccgtctctcccaagccaccttcatctttcaagatgtcgattagaaactgggtgacccgaacaccttcctcatcaccacccatcactccacctgcttcggagaccaagatcatgtctccgagaaaagcccttattcctgtgagccagaagtcatcccaagcagaggcttgctctgagtctagaaatagagtaaagaggaggctagactcaagctgtctggagagtgtgaaacaaaagtgtgtgaagagttgtaactgtgtgactgagcttgatggccaagttgaaaatcttcatttggatctgtgctgccttgctggtaaccaggaagaccttagtaaggactctctaggtcctaccaaatcaagcaaaattgaaggagctggtaccagtatctcagagcctccgtctcctatcagtccgtatgcttcagaaagctgtggaacgctacctcttcctttgagaccttgtggagaagggtctgaaatggtaggcaaagagaatagttccccagagaataaaaactggttgttggccatggcagccaaacggaaggctgagaatccatctccacgaagtccgtcatcccagacacccaattccaggagacagagcggaaagacattgccaagcccggtcaccatcacgcccagctccatgaggaaaatctgcacatacttccatagaaagtcccaggaggacttctgtggtcctgaacactcaacagagttatag
Sequence Length
2193
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,682 Da
NCBI Official Full Name
Homo sapiens denticleless homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
denticleless E3 ubiquitin protein ligase homolog
NCBI Official Symbol
DTL
NCBI Official Synonym Symbols
CDT2; RAMP; DCAF2; L2DTL
NCBI Protein Information
denticleless protein homolog
UniProt Protein Name
Denticleless protein homolog
Protein Family
UniProt Gene Name
DTL
UniProt Synonym Gene Names
CDT2; CDW1; DCAF2; L2DTL; RAMP
UniProt Entry Name
DTL_HUMAN

Uniprot Description

RAMP: Substrate-specific adapter of a DCX (DDB1-CUL4-X-box) E3 ubiquitin-protein ligase complex required for cell cycle control, DNA damage response and translesion DNA synthesis. The DCX(DTL) complex, also named CRL4(CDT2) complex, mediates the polyubiquitination and subsequent degradation of CDT1 and CDKN1A/p21(CIP1). CDT1 degradation in response to DNA damage is necessary to ensure proper cell cycle regulation of DNA replication. CDKN1A/p21(CIP1) degradation during S phase or following UV irradiation is essential to control replication licensing. Most substrates require their interaction with PCNA for their polyubiquitination: substrates interact with PCNA via their PIP-box, and those containing the 'K+4' motif in the PIP box, recruit the DCX(DTL) complex, leading to their degradation. In undamaged proliferating cells, the DCX(DTL) complex also promotes the 'Lys-164' monoubiquitination of PCNA, thereby being involved in PCNA-dependent translesion DNA synthesis. Belongs to the WD repeat cdt2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 1q32

Cellular Component: centrosome; cytoplasm; intracellular membrane-bound organelle; nucleolus; nucleoplasm; nucleus

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: bypass DNA synthesis; DNA damage response, detection of DNA damage; G2/M transition DNA damage checkpoint; protein monoubiquitination; protein polyubiquitination; regulation of cell cycle; response to DNA damage stimulus; response to UV; ubiquitin-dependent protein catabolic process

Research Articles on DTL

Similar Products

Product Notes

The DTL dtl (Catalog #AAA1271197) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctcttca attcggtgct ccgccagccc cagcttggcg tcctgagaaa tggatggtct tcacaatacc ctcttcaatc ccttctgact ggttatcagt gcagtggtaa tgatgaacac acttcttatg gagaaacagg agtcccagtt cctccttttg gatgtacctt ctcttctgct cccaatatgg aacatgtact agcagttgcc aatgaagaag gctttgttcg attgtataac acagaatcac aaagtttcag aaagaagtgc ttcaaagaat ggatggctca ctggaatgcc gtctttgacc tggcctgggt tcctggtgaa cttaaacttg ttacagcagc aggtgatcaa acagccaaat tttgggacgt aaaagctggt gagctgattg gaacatgcaa aggtcatcaa tgcagcctca agtcagttgc cttttctaag tttgagaaag ctgtattctg tacgggtgga agagatggca acattatggt ctgggatacc aggtgcaaca aaaaagatgg gttttatagg caagtgaatc aaatcagtgg agctcacaat acctcagaca agcaaacccc ttcaaaaccc aagaagaaac agaattcaaa aggacttgct ccttctgtgg atttccagca aagtgttact gtggtcctct ttcaagacga gaatacctta gtctcagcag gagctgtgga tgggataatc aaagtatggg atttacgtaa gaattatact gcttatcgac aagaacccat agcatccaag tctttcctgt acccaggtag cagcactcga aaacttggat attcaagtct gattttggat tccactggct ctactttatt tgctaattgc acagacgata acatctacat gtttaatatg actgggttga agacttctcc agtggctatt ttcaatggac accagaactc taccttttat gtaaaatcca gccttagtcc agatgaccag tttttagtca gtggctcaag tgatgaagct gcctacatat ggaaggtctc cacaccctgg caacctccta ctgtgctcct gggtcattct caagaggtca cgtctgtgtg ctggtgtcca tctgacttca caaagattgc tacctgttct gatgacaata cactaaaaat ctggcgcttg aatagaggct tagaggagaa accaggaggt gataaacttt ccacggtggg ttgggcctct cagaagaaaa aagagtcaag acctggccta gtaacagtaa cgagtagcca gagtactcct gccaaagccc ccagggtaaa gtgcaatcca tccaattctt ccccgtcatc cgcagcttgt gccccaagct gtgctggaga cctccctctt ccttcaaata ctcctacgtt ctctattaaa acctctcctg ccaaggcccg gtctcccatc aacagaagag gctctgtctc ctccgtctct cccaagccac cttcatcttt caagatgtcg attagaaact gggtgacccg aacaccttcc tcatcaccac ccatcactcc acctgcttcg gagaccaaga tcatgtctcc gagaaaagcc cttattcctg tgagccagaa gtcatcccaa gcagaggctt gctctgagtc tagaaataga gtaaagagga ggctagactc aagctgtctg gagagtgtga aacaaaagtg tgtgaagagt tgtaactgtg tgactgagct tgatggccaa gttgaaaatc ttcatttgga tctgtgctgc cttgctggta accaggaaga ccttagtaag gactctctag gtcctaccaa atcaagcaaa attgaaggag ctggtaccag tatctcagag cctccgtctc ctatcagtcc gtatgcttca gaaagctgtg gaacgctacc tcttcctttg agaccttgtg gagaagggtc tgaaatggta ggcaaagaga atagttcccc agagaataaa aactggttgt tggccatggc agccaaacgg aaggctgaga atccatctcc acgaagtccg tcatcccaga cacccaattc caggagacag agcggaaaga cattgccaag cccggtcacc atcacgccca gctccatgag gaaaatctgc acatacttcc atagaaagtc ccaggaggac ttctgtggtc ctgaacactc aacagagtta tag. It is sometimes possible for the material contained within the vial of "DTL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.