Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DPP7 cdna clone

DPP7 cDNA Clone

Gene Names
DPP7; QPP; DPP2; DPPII
Synonyms
DPP7; DPP7 cDNA Clone; DPP7 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctccgctccctgggccccggtcctgctgctggcgctcgggctgcgcggcctccaggcgggggcccgcagggccccggaccccggcttccaggagcgcttcttccagcagcgtctggaccacttcaacttcgagcgcttcggcaacaagaccttcccccagcgcttcctggtgtcggacaggttctgggtccggggcgaggggcccatcttcttctacactgggaacgagggcgacgtgtgggccttcgccaacaactcgggcttcgtcgcggagctggcggccgagcggggggctctactggtcttcgcggagcaccgctactacgggaagtcgctgccgttcggtgcgcagtccacgcagcgcgggcacacggagctgctgacggtggagcaggccctggccgacttcgcagagctgctccgcgcgctacgacgcgacctcggggcccaggatgcccccgccatcgccttcggtggaagttatggggggatgctcagtgcctacctgaggatgaagtatccccacctggtggcgggggcgctggcggccagcgcgcccgttctagctgtggcaggcctcggcgactccaaccagttcttccgggacgtcacggcggactttgagggccagagtcccaaatgcacccagggtgtgcgggaagcgttccgacagatcaaggacttgttcctacagggagcctacgacacggtccgctgggagttcggcacctgccagccgctgtcagacgagaaggacctgacccagctcttcatgttcgcccggaatgccttcaccgtgctggccatgatggactacccctaccccactgacttcctgggtcccctccctgccaaccccgtcaaggtgggctgtgatcggctgctgagtgaggcccagaggatcacggggctgcgagcactggcagggctggtctacaacgcctcgggctccgagcactgctacgacatctaccggctctaccacagctgtgctgaccccactggctgcggcaccggccccgacgccagggcctgggactaccaggcctgcaccgagatcaacctgaccttcgccagcaacaatgtgaccgatatgttccccgacctgcccttcactgacgagctccgccagcggtactgcctggacacctggggcgtgtggccccggcccgactggctgctgaccagcttctgggggggtgatctcagagccgccagcaacatcatcttctccaacgggaacctggacccctgggcagggggcgggattcggaggaacctgagtgcctcagtcatcgccgtcaccatccaggggggagcgcaccacctcgacctcagagcctcccacccagaagatcctgcttccgtggttgaggcgcggaagctggaggccaccatcatcggcgagtgggtaaaggcagccaggcgtgagcagcagccagctctgcgtggggggcccagactcagcctctga
Sequence Length
1479
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,341 Da
NCBI Official Full Name
Homo sapiens dipeptidyl-peptidase 7, mRNA
NCBI Official Synonym Full Names
dipeptidyl peptidase 7
NCBI Official Symbol
DPP7
NCBI Official Synonym Symbols
QPP; DPP2; DPPII
NCBI Protein Information
dipeptidyl peptidase 2
UniProt Protein Name
Dipeptidyl peptidase 2
Protein Family
UniProt Gene Name
DPP7
UniProt Synonym Gene Names
DPP2; QPP; DPP II
UniProt Entry Name
DPP2_HUMAN

NCBI Description

The protein encoded by this gene is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. The resting lymphocytes are maintained through suppression of apoptosis, a state which is disrupted by inhibition of this novel serine protease. The enzyme has strong sequence homology with prolylcarboxypeptidase and is active at both acidic and neutral pH. [provided by RefSeq, Jul 2008]

Uniprot Description

DPP7: Plays an important role in the degradation of some oligopeptides. Belongs to the peptidase S28 family.

Protein type: EC 3.4.14.2; Secreted, signal peptide; Protease; Secreted

Chromosomal Location of Human Ortholog: 9q34.3

Cellular Component: Golgi apparatus; intracellular membrane-bound organelle; vesicle

Molecular Function: dipeptidyl-peptidase activity; serine carboxypeptidase activity; serine-type peptidase activity

Research Articles on DPP7

Similar Products

Product Notes

The DPP7 dpp7 (Catalog #AAA1270673) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctccg ctccctgggc cccggtcctg ctgctggcgc tcgggctgcg cggcctccag gcgggggccc gcagggcccc ggaccccggc ttccaggagc gcttcttcca gcagcgtctg gaccacttca acttcgagcg cttcggcaac aagaccttcc cccagcgctt cctggtgtcg gacaggttct gggtccgggg cgaggggccc atcttcttct acactgggaa cgagggcgac gtgtgggcct tcgccaacaa ctcgggcttc gtcgcggagc tggcggccga gcggggggct ctactggtct tcgcggagca ccgctactac gggaagtcgc tgccgttcgg tgcgcagtcc acgcagcgcg ggcacacgga gctgctgacg gtggagcagg ccctggccga cttcgcagag ctgctccgcg cgctacgacg cgacctcggg gcccaggatg cccccgccat cgccttcggt ggaagttatg gggggatgct cagtgcctac ctgaggatga agtatcccca cctggtggcg ggggcgctgg cggccagcgc gcccgttcta gctgtggcag gcctcggcga ctccaaccag ttcttccggg acgtcacggc ggactttgag ggccagagtc ccaaatgcac ccagggtgtg cgggaagcgt tccgacagat caaggacttg ttcctacagg gagcctacga cacggtccgc tgggagttcg gcacctgcca gccgctgtca gacgagaagg acctgaccca gctcttcatg ttcgcccgga atgccttcac cgtgctggcc atgatggact acccctaccc cactgacttc ctgggtcccc tccctgccaa ccccgtcaag gtgggctgtg atcggctgct gagtgaggcc cagaggatca cggggctgcg agcactggca gggctggtct acaacgcctc gggctccgag cactgctacg acatctaccg gctctaccac agctgtgctg accccactgg ctgcggcacc ggccccgacg ccagggcctg ggactaccag gcctgcaccg agatcaacct gaccttcgcc agcaacaatg tgaccgatat gttccccgac ctgcccttca ctgacgagct ccgccagcgg tactgcctgg acacctgggg cgtgtggccc cggcccgact ggctgctgac cagcttctgg gggggtgatc tcagagccgc cagcaacatc atcttctcca acgggaacct ggacccctgg gcagggggcg ggattcggag gaacctgagt gcctcagtca tcgccgtcac catccagggg ggagcgcacc acctcgacct cagagcctcc cacccagaag atcctgcttc cgtggttgag gcgcggaagc tggaggccac catcatcggc gagtgggtaa aggcagccag gcgtgagcag cagccagctc tgcgtggggg gcccagactc agcctctga. It is sometimes possible for the material contained within the vial of "DPP7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.