Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DPM1 cdna clone

DPM1 cDNA Clone

Gene Names
DPM1; MPDS; CDGIE
Synonyms
DPM1; DPM1 cDNA Clone; DPM1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcctccttggaggtcagtcgtggtcctcgcaggtctcggcgggagctggaagtgcgcagtccacgacagaacaaatattcggtgcttttacctacctacaacgagcgcgagaacctgccgctcatcgtgtggctgctggtgaaaagcttctccgagagtggaatcaactatgaaattataatcatagatgatggaagcccagatggaacaagggatgttgctgaacagttggagaagatctatgggtcagacagaattcttctaagaccacgagagaaaaagttgggactaggaactgcatatattcatggaatgaaacatgccacaggaaactacatcattattatggatgctgatctctcacaccatccaaaatttattcctgaatttattaggaagcaaaaggagggtaattttgatattgtctctggaactcgctacaaaggaaatggaggtgtatatggctgggatttgaaaagaaaaataatcagccgtggggccaattttttaactcagatcttgctgagaccaggagcatctgatttaacaggaagtttcagattataccgaaaagaagttctagagaaattaatagaaaaatgtgtttctaaaggctacgtcttccagatggagatgattgttcgggcaagacagatgaattatactattggcgaggttccaatatcatttgtggatcgtgtttatggtgaatccaagttgggaggaaatgaaatagtatctttcttgaaaggattattgactctttttgctactacataa
Sequence Length
783
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,634 Da
NCBI Official Full Name
Homo sapiens dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit, mRNA
NCBI Official Synonym Full Names
dolichyl-phosphate mannosyltransferase subunit 1, catalytic
NCBI Official Symbol
DPM1
NCBI Official Synonym Symbols
MPDS; CDGIE
NCBI Protein Information
dolichol-phosphate mannosyltransferase subunit 1
UniProt Protein Name
Dolichol-phosphate mannosyltransferase subunit 1
UniProt Gene Name
DPM1
UniProt Synonym Gene Names
DPM synthase subunit 1; MPD synthase subunit 1
UniProt Entry Name
DPM1_HUMAN

NCBI Description

Dolichol-phosphate mannose (Dol-P-Man) serves as a donor of mannosyl residues on the lumenal side of the endoplasmic reticulum (ER). Lack of Dol-P-Man results in defective surface expression of GPI-anchored proteins. Dol-P-Man is synthesized from GDP-mannose and dolichol-phosphate on the cytosolic side of the ER by the enzyme dolichyl-phosphate mannosyltransferase. Human DPM1 lacks a carboxy-terminal transmembrane domain and signal sequence and is regulated by DPM2. Mutations in this gene are associated with congenital disorder of glycosylation type Ie. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]

Uniprot Description

DPM1: Transfers mannose from GDP-mannose to dolichol monophosphate to form dolichol phosphate mannose (Dol-P-Man) which is the mannosyl donor in pathways leading to N-glycosylation, glycosyl phosphatidylinositol membrane anchoring, and O- mannosylation of proteins. Defects in DPM1 are the cause of congenital disorder of glycosylation type 1E (CDG1E). CDGs are metabolic deficiencies in glycoprotein biosynthesis that usually cause severe mental and psychomotor retardation. They are characterized by under-glycosylated serum glycoproteins. CDG1E is an autosomal recessive disorder, characterized by severe developmental delay, hypotnia, seizures, and dysmorphic features. Belongs to the glycosyltransferase 2 family.

Protein type: Glycan Metabolism - N-glycan biosynthesis; EC 2.4.1.83; Transferase

Chromosomal Location of Human Ortholog: 20q13.13

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; membrane; nucleus

Molecular Function: dolichyl-phosphate beta-D-mannosyltransferase activity; dolichyl-phosphate-mannose-protein mannosyltransferase activity; protein binding

Biological Process: dolichol metabolic process; GPI anchor biosynthetic process; protein amino acid mannosylation; protein amino acid N-linked glycosylation; protein amino acid N-linked glycosylation via asparagine; protein amino acid O-linked mannosylation

Disease: Congenital Disorder Of Glycosylation, Type Ie

Similar Products

Product Notes

The DPM1 dpm1 (Catalog #AAA1270959) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcctcct tggaggtcag tcgtggtcct cgcaggtctc ggcgggagct ggaagtgcgc agtccacgac agaacaaata ttcggtgctt ttacctacct acaacgagcg cgagaacctg ccgctcatcg tgtggctgct ggtgaaaagc ttctccgaga gtggaatcaa ctatgaaatt ataatcatag atgatggaag cccagatgga acaagggatg ttgctgaaca gttggagaag atctatgggt cagacagaat tcttctaaga ccacgagaga aaaagttggg actaggaact gcatatattc atggaatgaa acatgccaca ggaaactaca tcattattat ggatgctgat ctctcacacc atccaaaatt tattcctgaa tttattagga agcaaaagga gggtaatttt gatattgtct ctggaactcg ctacaaagga aatggaggtg tatatggctg ggatttgaaa agaaaaataa tcagccgtgg ggccaatttt ttaactcaga tcttgctgag accaggagca tctgatttaa caggaagttt cagattatac cgaaaagaag ttctagagaa attaatagaa aaatgtgttt ctaaaggcta cgtcttccag atggagatga ttgttcgggc aagacagatg aattatacta ttggcgaggt tccaatatca tttgtggatc gtgtttatgg tgaatccaag ttgggaggaa atgaaatagt atctttcttg aaaggattat tgactctttt tgctactaca taa. It is sometimes possible for the material contained within the vial of "DPM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.