Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DPF3 cdna clone

DPF3 cDNA Clone

Gene Names
DPF3; CERD4; BAF45C
Synonyms
DPF3; DPF3 cDNA Clone; DPF3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgactgtcattcacaaccccctgaaagcgctcggggaccagttctacaaggaagccattgagcactgccggagttacaactcacggctgtgtgcagagcgcagcgtgcgtcttcccttcctggactcacagactggggtggcccagaacaactgctacatctggatggagaagaggcaccgaggcccaggccttgccccgggccagctgtatacataccctgcccgctgctggcgcaagaagagacgactgcacccacctgaagatccaaaactgcggctgctggagataaaacctgaagtggagcttcccctgaagaaggatgggttcacctcagagagcaccacgctggaagccttgctccgtggcgagggggttgagaagaaggtggatgccagggaggaggaaagcatccaggaaatacagagggttttggaaaatgatgaaaatgtagaagaagggaatgaagaagaggatttggaagaggatattcccaagcgaaagaacaggactagaggacgggctcacggctctgcagggggcaggaggaggcacgacgccgcctctcaggaagaccacgacaaaccttacgtctgtgacatctgtggcaagcgctacaagaaccgaccggggctcagctaccactatgctcacactcacctggccagcgaggagggggatgaagctcaagaccaggagactcggtccccacccaaccacagaaatgagaaccacaggccccagaaaggaccggatggaacagtcattcccaataactactgtgacttctgcttggggggctccaacatgaacaagaagagtgggcggcctgaagagctggtgtcctgcgcagactgtggacgctctgctcatttgggaggagaaggcaggaaggagaaggaggcagcggccgcagcacgtaccacggaggacttattcggttccacgtcagaaagtgacacgtcaactttccgcggctttgatgaggacgatttggaagagcctcgctcctgtcgaggacgccgcagtggccggggttcgcccacagcagataaaaagggcagttgctaa
Sequence Length
1074
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,184 Da
NCBI Official Full Name
Homo sapiens D4, zinc and double PHD fingers, family 3, mRNA
NCBI Official Synonym Full Names
double PHD fingers 3
NCBI Official Symbol
DPF3
NCBI Official Synonym Symbols
CERD4; BAF45C
NCBI Protein Information
zinc finger protein DPF3
UniProt Protein Name
Zinc finger protein DPF3
Protein Family
UniProt Gene Name
DPF3
UniProt Synonym Gene Names
BAF45C; CERD4; BAF45C
UniProt Entry Name
DPF3_HUMAN

NCBI Description

This gene encodes a member of the D4 protein family. The encoded protein is a transcription regulator that binds acetylated histones and is a component of the BAF chromatin remodeling complex. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]

Uniprot Description

DPF3: Belongs to the neuron-specific chromatin remodeling complex (nBAF complex). During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron-specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth. Muscle-specific component of the BAF complex, a multiprotein complex involved in transcriptional activation and repression of select genes by chromatin remodeling (alteration of DNA-nucleosome topology). Specifically binds acetylated lysines on histone 3 and 4 (H3K14ac, H3K9ac, H4K5ac, H4K8ac, H4K12ac, H4K16ac). In the complex, it acts as a tissue-specific anchor between histone acetylations and methylations and chromatin remodeling. It thereby probably plays an essential role in heart and skeletal muscle development. Belongs to the requiem/DPF family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 14q24.2

Biological Process: positive regulation of defense response to virus by host

Research Articles on DPF3

Similar Products

Product Notes

The DPF3 dpf3 (Catalog #AAA1272211) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgactg tcattcacaa ccccctgaaa gcgctcgggg accagttcta caaggaagcc attgagcact gccggagtta caactcacgg ctgtgtgcag agcgcagcgt gcgtcttccc ttcctggact cacagactgg ggtggcccag aacaactgct acatctggat ggagaagagg caccgaggcc caggccttgc cccgggccag ctgtatacat accctgcccg ctgctggcgc aagaagagac gactgcaccc acctgaagat ccaaaactgc ggctgctgga gataaaacct gaagtggagc ttcccctgaa gaaggatggg ttcacctcag agagcaccac gctggaagcc ttgctccgtg gcgagggggt tgagaagaag gtggatgcca gggaggagga aagcatccag gaaatacaga gggttttgga aaatgatgaa aatgtagaag aagggaatga agaagaggat ttggaagagg atattcccaa gcgaaagaac aggactagag gacgggctca cggctctgca gggggcagga ggaggcacga cgccgcctct caggaagacc acgacaaacc ttacgtctgt gacatctgtg gcaagcgcta caagaaccga ccggggctca gctaccacta tgctcacact cacctggcca gcgaggaggg ggatgaagct caagaccagg agactcggtc cccacccaac cacagaaatg agaaccacag gccccagaaa ggaccggatg gaacagtcat tcccaataac tactgtgact tctgcttggg gggctccaac atgaacaaga agagtgggcg gcctgaagag ctggtgtcct gcgcagactg tggacgctct gctcatttgg gaggagaagg caggaaggag aaggaggcag cggccgcagc acgtaccacg gaggacttat tcggttccac gtcagaaagt gacacgtcaa ctttccgcgg ctttgatgag gacgatttgg aagagcctcg ctcctgtcga ggacgccgca gtggccgggg ttcgcccaca gcagataaaa agggcagttg ctaa. It is sometimes possible for the material contained within the vial of "DPF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.