Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJC30 cdna clone

DNAJC30 cDNA Clone

Gene Names
DNAJC30; WBSCR18
Synonyms
DNAJC30; DNAJC30 cDNA Clone; DNAJC30 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagccatgcgctggcgatggtggcagcggctgttaccttggaggttgctgcaggcccgtggctttccacaaaattctgcacccagcctgggcctaagagcgaggacttattcccagggcgactgctcgtattcgcgcacggcgctgtatgatctgctcggcgtcccctccacagccacgcaggcccaaatcaaggcggcttactaccgtcagtgctttctctaccacccggaccgcaactccgggagcgcggaggccgccgagcgcttcacgcgcatctcccaggcctacgtggtgctgggcagtgccaccctccgtcgcaagtatgatcgcggcctactcagcgacgaggacctgcgcggacctggcgtccggccctccaggacgcccgcacccgaccccggctcgccgcgtaccccgccgcccacctctcggacccacgacggttctcgggcctcccccggcgccaaccgcacgatgttcaactttgacgccttctaccaggcccactacggggaacaactggagcgggaacggcgcctgagggcccggcgggaggcccttcgcaaacggcaggagtatcggtccatgaaaggcctccgctgggaggatacccgagacacggctgccattttcctcatcttttcaatcttcatcatcatcggcttttatatttaa
Sequence Length
681
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,961 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 30, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C30
NCBI Official Symbol
DNAJC30
NCBI Official Synonym Symbols
WBSCR18
NCBI Protein Information
dnaJ homolog subfamily C member 30
UniProt Protein Name
DnaJ homolog subfamily C member 30
Protein Family
UniProt Gene Name
DNAJC30
UniProt Synonym Gene Names
WBSCR18
UniProt Entry Name
DJC30_HUMAN

NCBI Description

This intronless gene encodes a member of the DNAJ molecular chaperone homology domain-containing protein family. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. [provided by RefSeq, Jul 2008]

Uniprot Description

DNAJC30: DNAJC30 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region.

Protein type: Mitochondrial; Chaperone

Chromosomal Location of Human Ortholog: 7q11.23

Research Articles on DNAJC30

Similar Products

Product Notes

The DNAJC30 dnajc30 (Catalog #AAA1270265) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagcca tgcgctggcg atggtggcag cggctgttac cttggaggtt gctgcaggcc cgtggctttc cacaaaattc tgcacccagc ctgggcctaa gagcgaggac ttattcccag ggcgactgct cgtattcgcg cacggcgctg tatgatctgc tcggcgtccc ctccacagcc acgcaggccc aaatcaaggc ggcttactac cgtcagtgct ttctctacca cccggaccgc aactccggga gcgcggaggc cgccgagcgc ttcacgcgca tctcccaggc ctacgtggtg ctgggcagtg ccaccctccg tcgcaagtat gatcgcggcc tactcagcga cgaggacctg cgcggacctg gcgtccggcc ctccaggacg cccgcacccg accccggctc gccgcgtacc ccgccgccca cctctcggac ccacgacggt tctcgggcct cccccggcgc caaccgcacg atgttcaact ttgacgcctt ctaccaggcc cactacgggg aacaactgga gcgggaacgg cgcctgaggg cccggcggga ggcccttcgc aaacggcagg agtatcggtc catgaaaggc ctccgctggg aggatacccg agacacggct gccattttcc tcatcttttc aatcttcatc atcatcggct tttatattta a. It is sometimes possible for the material contained within the vial of "DNAJC30, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.