DNAJC17 cdna clone
DNAJC17 cDNA Clone
Synonyms
DNAJC17; DNAJC17 cDNA Clone; DNAJC17 cdna clone
Sequence
atggcagtgaccaaggagctcttacagatggacctgtacgcgctgctaggcattgaggagaaggcagcggacaaagaggtaaagaaggcgtataggcagaaggccctctcctgccacccagacaaaaatccagataatcccagagcagctgaactcttccaccagctttctcaggccttggaggtgctgaccgatgctgcagccagggctgcatatgacaaggtcaggaaagccaagaagcaagcagcagagaggacccagaaacttgatgagaaaaggaagaaagtgaagcttgacctggaggcccgggagcggcaggcccaggcccaggagagtgaggaggaagaggagagccggagcaccaggacactagagcaagagatcgaacgcctgagagaagagggttcccggcagctggaggaacagcagaggctcatccgggagcagatacgccaggagcgtgaccagaggttgagaggaaaggcagaaaatactgaaggccaaggaacccccaaactaaagctaaaatggaagtgcaagaaggaggatgagtcaaaaggtggctactccaaagacgtcctcctacggcttttgcagaagtatggtgaggttctcaacctggtgctttccagtaagaagccaggcactgctgtggtggagtttgcaaccgtcaaggcagcggagctggctgtccagaatgaagttggcctggtggataaccctctgaagatttcctggttggagggacagccccaggatgccgtgggccgcagccactcaggactgtcaaagggctcagtgctgtcagagagggactacgagagcctcgtcatgatgcgcatgcgccaggcggccgagcggcaacagctgatcgcacggatgcagcaggaagaccaggaggggccgcctacgtag
Sequence Length
915
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,687 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 17, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C17
NCBI Official Symbol
DNAJC17
NCBI Protein Information
dnaJ homolog subfamily C member 17
UniProt Protein Name
DnaJ homolog subfamily C member 17
Protein Family
UniProt Gene Name
DNAJC17
UniProt Entry Name
DJC17_HUMAN
Uniprot Description
DNAJC17: May negatively affect PAX8-induced thyroglobulin/TG transcription. {ECO:0000250|UniProtKB:Q91WT4}
Protein type: Motility/polarity/chemotaxis; Chaperone
Chromosomal Location of Human Ortholog: 15q15.1
Research Articles on DNAJC17
Similar Products
Product Notes
The DNAJC17 dnajc17 (Catalog #AAA1271686) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagtga ccaaggagct cttacagatg gacctgtacg cgctgctagg cattgaggag aaggcagcgg acaaagaggt aaagaaggcg tataggcaga aggccctctc ctgccaccca gacaaaaatc cagataatcc cagagcagct gaactcttcc accagctttc tcaggccttg gaggtgctga ccgatgctgc agccagggct gcatatgaca aggtcaggaa agccaagaag caagcagcag agaggaccca gaaacttgat gagaaaagga agaaagtgaa gcttgacctg gaggcccggg agcggcaggc ccaggcccag gagagtgagg aggaagagga gagccggagc accaggacac tagagcaaga gatcgaacgc ctgagagaag agggttcccg gcagctggag gaacagcaga ggctcatccg ggagcagata cgccaggagc gtgaccagag gttgagagga aaggcagaaa atactgaagg ccaaggaacc cccaaactaa agctaaaatg gaagtgcaag aaggaggatg agtcaaaagg tggctactcc aaagacgtcc tcctacggct tttgcagaag tatggtgagg ttctcaacct ggtgctttcc agtaagaagc caggcactgc tgtggtggag tttgcaaccg tcaaggcagc ggagctggct gtccagaatg aagttggcct ggtggataac cctctgaaga tttcctggtt ggagggacag ccccaggatg ccgtgggccg cagccactca ggactgtcaa agggctcagt gctgtcagag agggactacg agagcctcgt catgatgcgc atgcgccagg cggccgagcg gcaacagctg atcgcacgga tgcagcagga agaccaggag gggccgccta cgtag. It is sometimes possible for the material contained within the vial of "DNAJC17, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
