DNAJC14 cdna clone

DNAJC14 cDNA Clone

Gene Names

DNAJC14; DNAJ; HDJ3; LIP6; DRIP78

Synonyms

DNAJC14; DNAJC14 cDNA Clone; DNAJC14 cdna clone

Ordering
Cat. Num. AAA1278870 For Research Use Only!

Sequence

atgaaacgaatggcagagaatgagctgagccggtcagtaaatgagtttctgtccaagctgcaagatgacctcaaggaggcaatgaatactatgatgtgtagccgatgccaaggaaagcataggaggtttgaaatggaccgggaacctaagagtgccagatactgtgctgagtgtaataggctgcatcctgctgaggaaggagacttttgggcagagtcaagcatgttgggcctcaagatcacctactttgcactgatggatggaaaggtgtatgacatcacagagtgggctggatgccagcgtgtaggtatctccccagatacccacagagtcccctatcacatctcatttggttctcggattccaggcaccagagggcggcagagagccaccccagatgcccctcctgctgatcttcaggatttcttgagtcggatctttcaagtacccccagggcagatgcccaatgggaacttctttgcagctcctcagcctgcccctggagccgctgcagcctctaagcccaacagcacagtacccaagggagaagccaaacctaagcggcggaagaaacttgccgaactaaagcaagaatgtcttgctcgtggtttggagaccaagggaataaagcaagatcttatccacagactccaggcatatcttgaagaacatgctgaagaggaggcaaatgaagaagatgtactgggagatgaaacagaggaagaagaaacaaagcccattgagctccctgtcaaagaggaagaaccccctgaaaaaactgttgatgtggcagcagagaagaaagtggtgaaaattacatctgaaataccacagactgagagaatgcagaagagggctgaacgattcaatgtacctgtgagcttggagagtaagaaagttgctcgggcagctaggtttgggatttcttcagttccaacaaaaggtctgtcatctgataacaaacctatggttaacttggataagctgaaggaaagagctcaaagatttggtttgaatgtctcttcaatctccagaaagtctgaagatgatgagaaactgaaaaagaggaaggagcgatttgggattgtcacaagttcagctggaactggaaccacagaggatacagaggcaaagaagaggaaaagagcagagcgctttgggattgcctga

Sequence Length

1170

Vector

pENTR223.1 or pUC

Clone Sequence Report

Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #

16877383

NCBI GeneID

85406

Molecular Weight

78,569 Da

NCBI Official Full Name

Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 14, mRNA

NCBI Official Synonym Full Names

DnaJ heat shock protein family (Hsp40) member C14

NCBI Official Symbol

DNAJC14

NCBI Official Synonym Symbols

DNAJ; HDJ3; LIP6; DRIP78

NCBI Protein Information

dnaJ homolog subfamily C member 14

UniProt Protein Name

DnaJ homolog subfamily C member 14

Protein Family

DnaJ homolog subfamily

UniProt Gene Name

DNAJC14

UniProt Synonym Gene Names

DRIP78; HDJ3; DRIP78; hDj-3

UniProt Entry Name

DJC14_HUMAN

Uniprot Description

DNAJC14: Regulates the export of target proteins, such as DRD1, from the endoplasmic reticulum to the cell surface.

Protein type: Membrane protein, integral; Endoplasmic reticulum; Membrane protein, multi-pass; Chaperone

Chromosomal Location of Human Ortholog: 12q13.2

Cellular Component: membrane; nucleolus; nucleoplasm

Research Articles on DNAJC14

1. This suggests that DNAJC14's folding activity normally modulates yellow fever virus NS3/4A/2K cleavage events to liberate appropriate levels of NS3 and NS4A and promote replication complex formation.

Similar Products

Product Notes

The DNAJC14 dnajc14 (Catalog #AAA1278870) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaacgaa tggcagagaa tgagctgagc cggtcagtaa atgagtttct gtccaagctg caagatgacc tcaaggaggc aatgaatact atgatgtgta gccgatgcca aggaaagcat aggaggtttg aaatggaccg ggaacctaag agtgccagat actgtgctga gtgtaatagg ctgcatcctg ctgaggaagg agacttttgg gcagagtcaa gcatgttggg cctcaagatc acctactttg cactgatgga tggaaaggtg tatgacatca cagagtgggc tggatgccag cgtgtaggta tctccccaga tacccacaga gtcccctatc acatctcatt tggttctcgg attccaggca ccagagggcg gcagagagcc accccagatg cccctcctgc tgatcttcag gatttcttga gtcggatctt tcaagtaccc ccagggcaga tgcccaatgg gaacttcttt gcagctcctc agcctgcccc tggagccgct gcagcctcta agcccaacag cacagtaccc aagggagaag ccaaacctaa gcggcggaag aaacttgccg aactaaagca agaatgtctt gctcgtggtt tggagaccaa gggaataaag caagatctta tccacagact ccaggcatat cttgaagaac atgctgaaga ggaggcaaat gaagaagatg tactgggaga tgaaacagag gaagaagaaa caaagcccat tgagctccct gtcaaagagg aagaaccccc tgaaaaaact gttgatgtgg cagcagagaa gaaagtggtg aaaattacat ctgaaatacc acagactgag agaatgcaga agagggctga acgattcaat gtacctgtga gcttggagag taagaaagtt gctcgggcag ctaggtttgg gatttcttca gttccaacaa aaggtctgtc atctgataac aaacctatgg ttaacttgga taagctgaag gaaagagctc aaagatttgg tttgaatgtc tcttcaatct ccagaaagtc tgaagatgat gagaaactga aaaagaggaa ggagcgattt gggattgtca caagttcagc tggaactgga accacagagg atacagaggc aaagaagagg aaaagagcag agcgctttgg gattgcctga. It is sometimes possible for the material contained within the vial of "DNAJC14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Loading...

DNAJC14 cdna clone