Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJC11 cdna clone

DNAJC11 cDNA Clone

Gene Names
DNAJC11; dJ126A5.1
Synonyms
DNAJC11; DNAJC11 cDNA Clone; DNAJC11 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgacggccttgagcgaggaggagctggacaatgaagactattactcgttgctgaacgtgcgcagggaggcctcttctgaagagctgaaagctgcctaccggaggctctgtatgctctaccatccagacaagcacagagacccagagctcaagtcacaggcggaacgactgtttaaccttgttcaccaggcttatgaagtgcttagtgacccccaaaccagggccatctatgatatatatgggaagagaggactggaaatggaaggatgggaggttgtggaaaggaggagaacccctgctgaaattcgagaggagtttgagcggctgcagagagagagagaagagaggagattgcagcagcgaaccaatcccaagggaacgatcagcgttggagtagatgccaccgacctttttgatcgctatgatgaggagtatgaagatgtgtccggcagtagctttccgcagattgaaattaataaaatgcacatatcccagtccattgaggcacccttgacagcgacagacacagccatcctctctggaagcctctcaacccagaatggaaatggaggaggttccattaactttgcgctcagacgagtaacttcggcaaagggatggggagagttggaatttggagctggagacctacaggggcctttgttcggtctcaagctgttccgtaatctcacaccaagatgctttgtgacaacaaactgtgctctgcagttttcatcccgtggaatccgacccggcctgaccactgtcctagctcggaacctagacaagaacaccgtgggctacctgcagtggcgatggggtatccagtcagccatgaacactagcatcgtccgagacactaaaagcagccacttcactgtggccctgcagctgggaatccctcactcctttgcactgatcagctatcagcacaaattccaagatgacgatcagactcgtgtgaaaggatccctcaaagcaggcttctttgggacggtggtggagtacggagctgagaggaagatctccaggcacagcgttttgggtgcagctgtcagcgttggagttccacagggcgtttctctcaaagtcaagctcaacagggccagtcagacatacttcttccctattcacttgacggaccagcttctgcccagcgccatgttctatgccaccgtggggcctctagtggtctactttgccatgcaccgtctgatcatcaaaccatacctcagggctcagaaagagaaggaattggagaagcagagggaaagcgccgccaccgatgtgctgcagaagaagcaagaggcggagtccgctgtccggctgatgcaggaatctgtccgaaggataattgaggcagaagagtccagaatgggcctcatcatcgtcaatgcctggtacgggaagtttgtcaatgacaagagcaggaagagcgagaaggtgaaggtgattgacgtgactgtgcccctgcagtgcctggtgaaggactcgaagctcatcctcacggaggcctccaaggctgggctgcctggcttttatgacccgtgtgtgggggaagagaagaacctgaaagtgctctatcagttccggggcgtcctgcatcaggtgatggtgctggacagtgaggccctccggataccaaagcagtcccacaggatcgatacagatggataa
Sequence Length
1680
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,197 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily C, member 11, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member C11
NCBI Official Symbol
DNAJC11
NCBI Official Synonym Symbols
dJ126A5.1
NCBI Protein Information
dnaJ homolog subfamily C member 11
UniProt Protein Name
DnaJ homolog subfamily C member 11
Protein Family
UniProt Gene Name
DNAJC11
UniProt Entry Name
DJC11_HUMAN

Uniprot Description

DNAJC11: Belongs to the DNAJC11 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Mitochondrial; Chaperone

Chromosomal Location of Human Ortholog: 1p36.31

Cellular Component: mitochondrion

Molecular Function: protein binding

Research Articles on DNAJC11

Similar Products

Product Notes

The DNAJC11 dnajc11 (Catalog #AAA1277875) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgacgg ccttgagcga ggaggagctg gacaatgaag actattactc gttgctgaac gtgcgcaggg aggcctcttc tgaagagctg aaagctgcct accggaggct ctgtatgctc taccatccag acaagcacag agacccagag ctcaagtcac aggcggaacg actgtttaac cttgttcacc aggcttatga agtgcttagt gacccccaaa ccagggccat ctatgatata tatgggaaga gaggactgga aatggaagga tgggaggttg tggaaaggag gagaacccct gctgaaattc gagaggagtt tgagcggctg cagagagaga gagaagagag gagattgcag cagcgaacca atcccaaggg aacgatcagc gttggagtag atgccaccga cctttttgat cgctatgatg aggagtatga agatgtgtcc ggcagtagct ttccgcagat tgaaattaat aaaatgcaca tatcccagtc cattgaggca cccttgacag cgacagacac agccatcctc tctggaagcc tctcaaccca gaatggaaat ggaggaggtt ccattaactt tgcgctcaga cgagtaactt cggcaaaggg atggggagag ttggaatttg gagctggaga cctacagggg cctttgttcg gtctcaagct gttccgtaat ctcacaccaa gatgctttgt gacaacaaac tgtgctctgc agttttcatc ccgtggaatc cgacccggcc tgaccactgt cctagctcgg aacctagaca agaacaccgt gggctacctg cagtggcgat ggggtatcca gtcagccatg aacactagca tcgtccgaga cactaaaagc agccacttca ctgtggccct gcagctggga atccctcact cctttgcact gatcagctat cagcacaaat tccaagatga cgatcagact cgtgtgaaag gatccctcaa agcaggcttc tttgggacgg tggtggagta cggagctgag aggaagatct ccaggcacag cgttttgggt gcagctgtca gcgttggagt tccacagggc gtttctctca aagtcaagct caacagggcc agtcagacat acttcttccc tattcacttg acggaccagc ttctgcccag cgccatgttc tatgccaccg tggggcctct agtggtctac tttgccatgc accgtctgat catcaaacca tacctcaggg ctcagaaaga gaaggaattg gagaagcaga gggaaagcgc cgccaccgat gtgctgcaga agaagcaaga ggcggagtcc gctgtccggc tgatgcagga atctgtccga aggataattg aggcagaaga gtccagaatg ggcctcatca tcgtcaatgc ctggtacggg aagtttgtca atgacaagag caggaagagc gagaaggtga aggtgattga cgtgactgtg cccctgcagt gcctggtgaa ggactcgaag ctcatcctca cggaggcctc caaggctggg ctgcctggct tttatgaccc gtgtgtgggg gaagagaaga acctgaaagt gctctatcag ttccggggcg tcctgcatca ggtgatggtg ctggacagtg aggccctccg gataccaaag cagtcccaca ggatcgatac agatggataa. It is sometimes possible for the material contained within the vial of "DNAJC11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.