Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJB6 cdna clone

DNAJB6 cDNA Clone

Gene Names
DNAJB6; DJ4; MRJ; DnaJ; HSJ2; HHDJ1; HSJ-2; MSJ-1; LGMD1D; LGMD1E
Synonyms
DNAJB6; DNAJB6 cDNA Clone; DNAJB6 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggattactatgaagttctaggcgtgcagagacatgcctcacccgaggatattaaaaaggcatatcggaaactggcactgaagtggcatccagataaaaatcctgagaataaagaagaagcagagagaaaattcaagcaagtagcggaggcatatgaagtgctgtcggatgctaagaaacgggacatctatgacaaatatggcaaagaaggattaaatggtggaggaggaggtggaagtcattttgacagtccatttgaatttggcttcacattccgtaacccagatgatgtcttcagggaattttttggtggaagggacccattttcatttgacttctttgaagacccttttgaggacttctttgggaatcgaaggggtccccgaggaagcagaagccgagggacggggtcgtttttctctgcgttcagtggatttccgtcttttggaagtggattttcttcttttgatacaggatttacttcatttgggtcactaggtcacgggggcctcacttcattctcttccacgtcatttggtggtagtggcatgggcaacttcaaatcgatatcaacttcaactaaaatggttaatggcagaaaaatcactacaaagagaattgtcgagaacggtcaagaaagagtagaagttgaagaagatggccagttaaagtccttaacaataaatggtgtggccgacgacgatgccctcgctgaggagcgcatgcggagaggccagaacgccctgccagcccagcctgccggcctccgcccgccgaagccgccccggcctgcctcgctgctgagacacgcgcctcactgtctctctgaggaggagggcgagcaggaccgacctcgggcacccgggccctgggaccccctcgcgtccgcagcaggattgaaagaaggtggcaagaggaagaagcagaagcagagagaggagtcgaagaagaagaagtcgaccaaaggcaatcactag
Sequence Length
981
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,369 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 6, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member B6
NCBI Official Symbol
DNAJB6
NCBI Official Synonym Symbols
DJ4; MRJ; DnaJ; HSJ2; HHDJ1; HSJ-2; MSJ-1; LGMD1D; LGMD1E
NCBI Protein Information
dnaJ homolog subfamily B member 6
UniProt Protein Name
DnaJ homolog subfamily B member 6
Protein Family
UniProt Gene Name
DNAJB6
UniProt Synonym Gene Names
HSJ2; MRJ; MSJ1; HSJ-2
UniProt Entry Name
DNJB6_HUMAN

NCBI Description

This gene encodes a member of the DNAJ protein family. DNAJ family members are characterized by a highly conserved amino acid stretch called the 'J-domain' and function as one of the two major classes of molecular chaperones involved in a wide range of cellular events, such as protein folding and oligomeric protein complex assembly. This family member may also play a role in polyglutamine aggregation in specific neurons. Alternative splicing of this gene results in multiple transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]

Uniprot Description

DNAJB6: Plays an indispensable role in the organization of KRT8/KRT18 filaments. Acts as an endogenous molecular chaperone for neuronal proteins including huntingtin. Suppresses aggregation and toxicity of polyglutamine-containing, aggregation-prone proteins. Isoform B but not isoform A inhibits huntingtin aggregation. Has a stimulatory effect on the ATPase activity of HSP70 in a dose-dependent and time-dependent manner and hence acts as a co-chaperone of HSP70. Also reduces cellular toxicity and caspase-3 activity. Defects in DNAJB6 are the cause of limb-girdle muscular dystrophy type 1E (LGMD1E). An autosomal dominant myopathy characterized by adult onset of proximal muscle weakness, beginning in the hip girdle region and later progressing to the shoulder girdle region. There is evidence that LGMD1E is caused by dysfunction of isoform B (PubMed:22366786). 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Chaperone

Chromosomal Location of Human Ortholog: 7q36.3

Cellular Component: cytosol; membrane; nucleoplasm; nucleus; perinuclear region of cytoplasm; Z disc

Molecular Function: ATPase activator activity; chaperone binding; heat shock protein binding; protein binding; unfolded protein binding

Biological Process: intermediate filament organization; negative regulation of caspase activity; protein folding; regulation of protein localization

Disease: Muscular Dystrophy, Limb-girdle, Type 1e

Research Articles on DNAJB6

Similar Products

Product Notes

The DNAJB6 dnajb6 (Catalog #AAA1266633) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggatt actatgaagt tctaggcgtg cagagacatg cctcacccga ggatattaaa aaggcatatc ggaaactggc actgaagtgg catccagata aaaatcctga gaataaagaa gaagcagaga gaaaattcaa gcaagtagcg gaggcatatg aagtgctgtc ggatgctaag aaacgggaca tctatgacaa atatggcaaa gaaggattaa atggtggagg aggaggtgga agtcattttg acagtccatt tgaatttggc ttcacattcc gtaacccaga tgatgtcttc agggaatttt ttggtggaag ggacccattt tcatttgact tctttgaaga cccttttgag gacttctttg ggaatcgaag gggtccccga ggaagcagaa gccgagggac ggggtcgttt ttctctgcgt tcagtggatt tccgtctttt ggaagtggat tttcttcttt tgatacagga tttacttcat ttgggtcact aggtcacggg ggcctcactt cattctcttc cacgtcattt ggtggtagtg gcatgggcaa cttcaaatcg atatcaactt caactaaaat ggttaatggc agaaaaatca ctacaaagag aattgtcgag aacggtcaag aaagagtaga agttgaagaa gatggccagt taaagtcctt aacaataaat ggtgtggccg acgacgatgc cctcgctgag gagcgcatgc ggagaggcca gaacgccctg ccagcccagc ctgccggcct ccgcccgccg aagccgcccc ggcctgcctc gctgctgaga cacgcgcctc actgtctctc tgaggaggag ggcgagcagg accgacctcg ggcacccggg ccctgggacc ccctcgcgtc cgcagcagga ttgaaagaag gtggcaagag gaagaagcag aagcagagag aggagtcgaa gaagaagaag tcgaccaaag gcaatcacta g. It is sometimes possible for the material contained within the vial of "DNAJB6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.