Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJB2 cdna clone

DNAJB2 cDNA Clone

Gene Names
DNAJB2; HSJ1; CMT2T; DSMA5; HSJ-1; HSPF3
Synonyms
DNAJB2; DNAJB2 cDNA Clone; DNAJB2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcatcctactacgagatcctagacgtgccgcgaagtgcgtccgctgatgacatcaagaaggcgtatcggcgcaaggctctccagtggcacccagacaaaaacccagataataaagagtttgctgagaagaaatttaaggaggtggccgaggcatatgaagtgctgtctgacaagcacaagcgggagatttacgaccgctatggccgggaagggctgacagggacaggaactggcccatctcgggcagaagctggcagtggtgggcctggcttcaccttcaccttccgcagccccgaggaggtcttccgggaattctttgggagtggagacccttttgcagagctctttgatgacctgggccccttctcagagcttcagaaccggggttcccgacactcaggccccttctttaccttctcttcctccttccctgggcactccgatttctcctcctcatctttctccttcagtcctggggctggtgcttttcgctctgtttctacatctaccacctttgtccaaggacgccgcatcaccacacgcagaatcatggagaacgggcaggagcgggtggaagtggaggaggatgggcagctgaagtcagtcacaatcaatggtgtcccagatgacctggcactgggcttggagctgagccgtcgcgagcagcagccgtcagtcacttccaggtctgggggcactcaggtccagcagacccctgcctcatgccccttggacagcgacctctctgaggatgaggacctgcagctggccatggcctacagcctgtcagagatggaggcagctgggaagaaacccgcaggtgggcgggaggcacagcaccgacggcaggggcggcccaaggcccagcaccaagatccaggcttgggggggacccaggagggtgcgaggggtgaagcaaccaaacgcagtccatccccagaggagaaggcctctcgctgcctcatcctctga
Sequence Length
975
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,569 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 2, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member B2
NCBI Official Symbol
DNAJB2
NCBI Official Synonym Symbols
HSJ1; CMT2T; DSMA5; HSJ-1; HSPF3
NCBI Protein Information
dnaJ homolog subfamily B member 2
UniProt Protein Name
DnaJ homolog subfamily B member 2
Protein Family
UniProt Gene Name
DNAJB2
UniProt Synonym Gene Names
HSJ1; HSPF3; HSJ-1
UniProt Entry Name
DNJB2_HUMAN

NCBI Description

This gene is almost exclusively expressed in the brain, mainly in the neuronal layers. It encodes a protein that shows sequence similarity to bacterial DnaJ protein and the yeast homologs. In bacteria, this protein is implicated in protein folding and protein complex dissociation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]

Uniprot Description

DNAJB2: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Chaperone

Chromosomal Location of Human Ortholog: 2q35

Cellular Component: cytosol; nucleus

Molecular Function: chaperone binding; unfolded protein binding

Biological Process: protein folding; protein refolding; response to unfolded protein

Disease: Charcot-marie-tooth Disease, Axonal, Type 2t; Spinal Muscular Atrophy, Distal, Autosomal Recessive, 5

Research Articles on DNAJB2

Similar Products

Product Notes

The DNAJB2 dnajb2 (Catalog #AAA1277723) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatcct actacgagat cctagacgtg ccgcgaagtg cgtccgctga tgacatcaag aaggcgtatc ggcgcaaggc tctccagtgg cacccagaca aaaacccaga taataaagag tttgctgaga agaaatttaa ggaggtggcc gaggcatatg aagtgctgtc tgacaagcac aagcgggaga tttacgaccg ctatggccgg gaagggctga cagggacagg aactggccca tctcgggcag aagctggcag tggtgggcct ggcttcacct tcaccttccg cagccccgag gaggtcttcc gggaattctt tgggagtgga gacccttttg cagagctctt tgatgacctg ggccccttct cagagcttca gaaccggggt tcccgacact caggcccctt ctttaccttc tcttcctcct tccctgggca ctccgatttc tcctcctcat ctttctcctt cagtcctggg gctggtgctt ttcgctctgt ttctacatct accacctttg tccaaggacg ccgcatcacc acacgcagaa tcatggagaa cgggcaggag cgggtggaag tggaggagga tgggcagctg aagtcagtca caatcaatgg tgtcccagat gacctggcac tgggcttgga gctgagccgt cgcgagcagc agccgtcagt cacttccagg tctgggggca ctcaggtcca gcagacccct gcctcatgcc ccttggacag cgacctctct gaggatgagg acctgcagct ggccatggcc tacagcctgt cagagatgga ggcagctggg aagaaacccg caggtgggcg ggaggcacag caccgacggc aggggcggcc caaggcccag caccaagatc caggcttggg ggggacccag gagggtgcga ggggtgaagc aaccaaacgc agtccatccc cagaggagaa ggcctctcgc tgcctcatcc tctga. It is sometimes possible for the material contained within the vial of "DNAJB2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.