DNAJB14 cdna clone
DNAJB14 cDNA Clone
Gene Names
DNAJB14; EGNR9427; PRO34683
Synonyms
DNAJB14; DNAJB14 cDNA Clone; DNAJB14 cdna clone
Sequence
atggaggggaacagggatgaggctgagaaatgtgtcgagatcgcccgggaggccctgaacgccggcaaccgcgagaaggcccagcgcttcctgcagaaggccgagaagctctacccactgccctcggcccgcgcactattggaaataattatgaaaaatggaagcacggctggaaatagccctcattgccgaaaaccatcaggtagtggcgatcaaagcaagcctaattgcacaaaggacagcacatctggtagtggtgaaggtggaaaaggctataccaaagaccaagtagatggagttctcagcataaacaaatgtaaaaattactatgaagtacttggagttacgaaagatgctggtgatgaagatttgaaaaaagcttatagaaagcttgctttgaagtttcatccagacaaaaaccatgcacctggagcaacagatgcttttaaaaagattggaaatgcttatgctgttttaagtaatccagaaaagcgaaaacagtatgacctcacgggcaatgaagaacaagcatgtaaccaccaaaacaatggcagatttaatttccatagaggttgtgaagctgatataactccagaagacttgtttaatatattttttgggggtggatttccttcaggtagtgtacattctttttcaaatggaagagctggttatagccaacaacatcagcatcgacatagtggacatgaaagagaagaggaaagaggagatggaggtttttctgtgtttatccagctgatgcccataattgtattgatcctcgtgtcattattaagccagttgatggtctctaatcctccttattccttatatcccagatctggaactgggcaaactattaaaatgcaaacagaaaacttgggtgttgtttattatgtcaacaaggacttcaaaaatgaatataaaggaatgttattacaaaaggtagaaaagagtgtggaggaagattatgtgactaatattcgaaataactgctggaaagaaagacaacaaaaaacagatatgcagtatgcagcaaaagtataccgtgatgatcgactccgaaggaaggcagatgccttgagcatggacaactgtaaagaattagagcggcttaccagtctttataaaggaggatga
Sequence Length
1140
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
33,471 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 14, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member B14
NCBI Official Symbol
DNAJB14
NCBI Official Synonym Symbols
EGNR9427; PRO34683
NCBI Protein Information
dnaJ homolog subfamily B member 14
UniProt Protein Name
DnaJ homolog subfamily B member 14
Protein Family
UniProt Gene Name
DNAJB14
UniProt Entry Name
DJB14_HUMAN
Uniprot Description
DNAJB14: May act as a co-chaperone. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral; Chaperone
Chromosomal Location of Human Ortholog: 4q23
Cellular Component: membrane
Research Articles on DNAJB14
Similar Products
Product Notes
The DNAJB14 dnajb14 (Catalog #AAA1271660) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagggga acagggatga ggctgagaaa tgtgtcgaga tcgcccggga ggccctgaac gccggcaacc gcgagaaggc ccagcgcttc ctgcagaagg ccgagaagct ctacccactg ccctcggccc gcgcactatt ggaaataatt atgaaaaatg gaagcacggc tggaaatagc cctcattgcc gaaaaccatc aggtagtggc gatcaaagca agcctaattg cacaaaggac agcacatctg gtagtggtga aggtggaaaa ggctatacca aagaccaagt agatggagtt ctcagcataa acaaatgtaa aaattactat gaagtacttg gagttacgaa agatgctggt gatgaagatt tgaaaaaagc ttatagaaag cttgctttga agtttcatcc agacaaaaac catgcacctg gagcaacaga tgcttttaaa aagattggaa atgcttatgc tgttttaagt aatccagaaa agcgaaaaca gtatgacctc acgggcaatg aagaacaagc atgtaaccac caaaacaatg gcagatttaa tttccataga ggttgtgaag ctgatataac tccagaagac ttgtttaata tattttttgg gggtggattt ccttcaggta gtgtacattc tttttcaaat ggaagagctg gttatagcca acaacatcag catcgacata gtggacatga aagagaagag gaaagaggag atggaggttt ttctgtgttt atccagctga tgcccataat tgtattgatc ctcgtgtcat tattaagcca gttgatggtc tctaatcctc cttattcctt atatcccaga tctggaactg ggcaaactat taaaatgcaa acagaaaact tgggtgttgt ttattatgtc aacaaggact tcaaaaatga atataaagga atgttattac aaaaggtaga aaagagtgtg gaggaagatt atgtgactaa tattcgaaat aactgctgga aagaaagaca acaaaaaaca gatatgcagt atgcagcaaa agtataccgt gatgatcgac tccgaaggaa ggcagatgcc ttgagcatgg acaactgtaa agaattagag cggcttacca gtctttataa aggaggatga. It is sometimes possible for the material contained within the vial of "DNAJB14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
