Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJA2 cdna clone

DNAJA2 cDNA Clone

Gene Names
DNAJA2; DJ3; CPR3; DJA2; DNAJ; DNJ3; RDJ2; HIRIP4; PRO3015
Synonyms
DNAJA2; DNAJA2 cDNA Clone; DNAJA2 cdna clone
Ordering
For Research Use Only!
Sequence
atggctaacgtggctgacacgaagctgtacgacatcctgggcgtcccgcccggcgccagcgagaacgagctgaagaaggcatacagaaagttagccaaggaatatcatcctgataagaatccaaatgcaggagacaaatttaaagaaataagttttgcatatgaagtactatcaaatcctgagaagcgtgagttatatgacagatacggagagcaaggtcttcgggaaggcagcggcggaggtggtggcatggatgatattttctctcacatttttggtgggggattgttcggcttcatgggcaatcagagtagaagtcgaaatggcagaagaagaggagaggacatgatgcatccactcaaagtatctttagaagatctgtataatggcaagacaaccaaactacaacttagcaagaatgtgctctgtagtgcatgcagtggccaaggcggaaagtctggagctgtccaaaagtgtagtgcttgtcgaggtcgaggtgtgcgcatcatgatcagacagctggctccagggatggtacaacagatgcagtctgtgtgctctgattgtaatggagaaggagaggtaattaatgaaaaagaccgctgtaaaaaatgtgaagggaagaaggtgattaaagaagtcaagattcttgaagtccacgtagacaaaggcatgaaacatggacagagaattacattcactggggaagcagaccaggccccaggagtggaacccggagacattgttcttttgctacaggagaaagaacatgaggtatttcagagagatgggaatgatttgcacatgacatataaaataggacttgttgaagctctatgtggatttcagttcacatttaagcaccttgatggacgtcagattgtggtgaaatacccccctggcaaagtaattgaaccagggtgtgttcgtgtagttcgaggtgaagggatgccgcagtatcgtaatccctttgaaaaaggtgatctttacataaagtttgatgtgcagtttcctgaaaacaactggatcaacccagacaagctttctgaactagaagatcttctgccatctagaccggaagttcctaacataattggagaaacagaggaggtagagcttcaggaatttgatagcactcgaggctcaggaggtggtcagaggcgtgaagcctataatgatagctctgatgaagaaagcagcagccatcatggacctggagtgcagtgtgcccatcagtaa
Sequence Length
1239
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,746 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily A, member 2, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member A2
NCBI Official Symbol
DNAJA2
NCBI Official Synonym Symbols
DJ3; CPR3; DJA2; DNAJ; DNJ3; RDJ2; HIRIP4; PRO3015
NCBI Protein Information
dnaJ homolog subfamily A member 2
UniProt Protein Name
DnaJ homolog subfamily A member 2
Protein Family
UniProt Gene Name
DNAJA2
UniProt Synonym Gene Names
CPR3; HIRIP4; Dj3
UniProt Entry Name
DNJA2_HUMAN

NCBI Description

The protein encoded by this gene belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain. The product of this gene works as a cochaperone of Hsp70s in protein folding and mitochondrial protein import in vitro. [provided by RefSeq, Jul 2008]

Uniprot Description

DNAJA2: Co-chaperone of Hsc70.

Protein type: Cell cycle regulation; Chaperone

Chromosomal Location of Human Ortholog: 16q12.1

Cellular Component: cytosol

Molecular Function: chaperone binding; protein binding; unfolded protein binding

Biological Process: positive regulation of cell proliferation; protein refolding

Research Articles on DNAJA2

Similar Products

Product Notes

The DNAJA2 dnaja2 (Catalog #AAA1273486) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaacg tggctgacac gaagctgtac gacatcctgg gcgtcccgcc cggcgccagc gagaacgagc tgaagaaggc atacagaaag ttagccaagg aatatcatcc tgataagaat ccaaatgcag gagacaaatt taaagaaata agttttgcat atgaagtact atcaaatcct gagaagcgtg agttatatga cagatacgga gagcaaggtc ttcgggaagg cagcggcgga ggtggtggca tggatgatat tttctctcac atttttggtg ggggattgtt cggcttcatg ggcaatcaga gtagaagtcg aaatggcaga agaagaggag aggacatgat gcatccactc aaagtatctt tagaagatct gtataatggc aagacaacca aactacaact tagcaagaat gtgctctgta gtgcatgcag tggccaaggc ggaaagtctg gagctgtcca aaagtgtagt gcttgtcgag gtcgaggtgt gcgcatcatg atcagacagc tggctccagg gatggtacaa cagatgcagt ctgtgtgctc tgattgtaat ggagaaggag aggtaattaa tgaaaaagac cgctgtaaaa aatgtgaagg gaagaaggtg attaaagaag tcaagattct tgaagtccac gtagacaaag gcatgaaaca tggacagaga attacattca ctggggaagc agaccaggcc ccaggagtgg aacccggaga cattgttctt ttgctacagg agaaagaaca tgaggtattt cagagagatg ggaatgattt gcacatgaca tataaaatag gacttgttga agctctatgt ggatttcagt tcacatttaa gcaccttgat ggacgtcaga ttgtggtgaa atacccccct ggcaaagtaa ttgaaccagg gtgtgttcgt gtagttcgag gtgaagggat gccgcagtat cgtaatccct ttgaaaaagg tgatctttac ataaagtttg atgtgcagtt tcctgaaaac aactggatca acccagacaa gctttctgaa ctagaagatc ttctgccatc tagaccggaa gttcctaaca taattggaga aacagaggag gtagagcttc aggaatttga tagcactcga ggctcaggag gtggtcagag gcgtgaagcc tataatgata gctctgatga agaaagcagc agccatcatg gacctggagt gcagtgtgcc catcagtaa. It is sometimes possible for the material contained within the vial of "DNAJA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.