Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DNAJA1 cdna clone

DNAJA1 cDNA Clone

Gene Names
DNAJA1; DJ-2; DjA1; HDJ2; HSDJ; HSJ2; HSJ-2; HSPF4; NEDD7; hDJ-2
Synonyms
DNAJA1; DNAJA1 cDNA Clone; DNAJA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgaaagaaacaacttactacgatgttttgggggtcaaacccaatgctactcaggaagaattgaaaaaggcttataggaaactggccttgaagtaccatcctgataagaacccaaatgaaggagagaagtttaaacagatttctcaagcttacgaagttctctctgatgcaaagaaaagggaattatatgacaaaggaggagaacaggcaattaaagagggtggagcaggtggcggttttggctcccccatggacatctttgatatgttttttggaggaggaggaaggatgcagagagaaaggagaggtaaaaatgttgtacatcagctctcagtaaccctagaagacttatataatggtgcaacaagaaaactggctctgcaaaagaatgtgatttgtgacaaatgtgaaggtagaggaggtaagaaaggagcagtagagtgctgtcccaattgccgaggtactggaatgcaaataagaattcatcagataggacctggaatggttcagcaaattcagtctgtgtgcatggagtgccagggccatggggagcggatcagtcctaaagatagatgtaaaagctgcaacggaaggaagatagttcgagagaagaaaattttagaagttcatattgacaaaggcatgaaagatggccagaagataacattccatggtgaaggagaccaagaaccaggactggagccaggcgatattatcattgtgttagatcagaaggaccatgctgtttttactcgacgaggagaagaccttttcatgtgtatggacatacagctcgttgaagcactgtgtggcttccagaagccaatatctactcttgacaaccgaaccatcgtcatcacctctcatccaggtcagattgtcaagcatggagatatcaagtgtgtactaaatgaaggcatgccaatttatcgtagaccatatgaaaagggtcgcctaatcatcgaatttaaggtaaactttcctgagaatggctttctctctcctgataaactgtctttgctggaaaaactcctacccgagaggaaggaagtggaagagactgatgagatggaccaagtagaactggtggactttgatccaaatcaggaaagacggcgccactacaatggagaagcatatgaggatgatgaacatcatcccagaggtggtgttcagtgtcagacctcttaa
Sequence Length
1194
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,045 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily A, member 1, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member A1
NCBI Official Symbol
DNAJA1
NCBI Official Synonym Symbols
DJ-2; DjA1; HDJ2; HSDJ; HSJ2; HSJ-2; HSPF4; NEDD7; hDJ-2
NCBI Protein Information
dnaJ homolog subfamily A member 1
UniProt Protein Name
DnaJ homolog subfamily A member 1
Protein Family
UniProt Gene Name
DNAJA1
UniProt Synonym Gene Names
DNAJ2; HDJ2; HSJ2; HSPF4; HSJ-2; hDj-2
UniProt Entry Name
DNJA1_HUMAN

NCBI Description

This gene encodes a member of the DnaJ family of proteins, which act as heat shock protein 70 cochaperones. Heat shock proteins facilitate protein folding, trafficking, prevention of aggregation, and proteolytic degradation. Members of this family are characterized by a highly conserved N-terminal J domain, a glycine/phenylalanine-rich region, four CxxCxGxG zinc finger repeats, and a C-terminal substrate-binding domain. The J domain mediates the interaction with heat shock protein 70 to recruit substrates and regulate ATP hydrolysis activity. In humans, this gene has been implicated in positive regulation of virus replication through co-option by the influenza A virus. Several pseudogenes of this gene are found on other chromosomes. [provided by RefSeq, Sep 2015]

Uniprot Description

DNAJA1: Co-chaperone of Hsc70. Seems to play a role in protein import into mitochondria.

Protein type: Chaperone; Nuclear receptor co-regulator

Chromosomal Location of Human Ortholog: 9p13.3

Cellular Component: cytosol; membrane; ubiquitin ligase complex

Molecular Function: chaperone binding; G-protein-coupled receptor binding; Hsp70 protein binding; low-density lipoprotein receptor binding; protein binding; Tat protein binding; ubiquitin protein ligase binding

Biological Process: negative regulation of apoptosis; negative regulation of JNK activity; negative regulation of protein ubiquitination; positive regulation of apoptosis; regulation of protein transport; response to unfolded protein

Research Articles on DNAJA1

Similar Products

Product Notes

The DNAJA1 dnaja1 (Catalog #AAA1276927) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgaaag aaacaactta ctacgatgtt ttgggggtca aacccaatgc tactcaggaa gaattgaaaa aggcttatag gaaactggcc ttgaagtacc atcctgataa gaacccaaat gaaggagaga agtttaaaca gatttctcaa gcttacgaag ttctctctga tgcaaagaaa agggaattat atgacaaagg aggagaacag gcaattaaag agggtggagc aggtggcggt tttggctccc ccatggacat ctttgatatg ttttttggag gaggaggaag gatgcagaga gaaaggagag gtaaaaatgt tgtacatcag ctctcagtaa ccctagaaga cttatataat ggtgcaacaa gaaaactggc tctgcaaaag aatgtgattt gtgacaaatg tgaaggtaga ggaggtaaga aaggagcagt agagtgctgt cccaattgcc gaggtactgg aatgcaaata agaattcatc agataggacc tggaatggtt cagcaaattc agtctgtgtg catggagtgc cagggccatg gggagcggat cagtcctaaa gatagatgta aaagctgcaa cggaaggaag atagttcgag agaagaaaat tttagaagtt catattgaca aaggcatgaa agatggccag aagataacat tccatggtga aggagaccaa gaaccaggac tggagccagg cgatattatc attgtgttag atcagaagga ccatgctgtt tttactcgac gaggagaaga ccttttcatg tgtatggaca tacagctcgt tgaagcactg tgtggcttcc agaagccaat atctactctt gacaaccgaa ccatcgtcat cacctctcat ccaggtcaga ttgtcaagca tggagatatc aagtgtgtac taaatgaagg catgccaatt tatcgtagac catatgaaaa gggtcgccta atcatcgaat ttaaggtaaa ctttcctgag aatggctttc tctctcctga taaactgtct ttgctggaaa aactcctacc cgagaggaag gaagtggaag agactgatga gatggaccaa gtagaactgg tggactttga tccaaatcag gaaagacggc gccactacaa tggagaagca tatgaggatg atgaacatca tcccagaggt ggtgttcagt gtcagacctc ttaa. It is sometimes possible for the material contained within the vial of "DNAJA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.