Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DLGAP5 cdna clone

DLGAP5 cDNA Clone

Synonyms
DLGAP5; DLGAP5 cDNA Clone; DLGAP5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcttcatcacattttgccagtcgacacaggaaggatataagtactgaaatgattagaactaaaattgctcataggaaatcactgtctcagaaagaaaatagacataaggaatacgaacgaaatagacactttggtttgaaagatgtaaacattccaaccttggaaggtagaattcttgttgaattagatgagacatctcaagggcttgttccagaaaagaccaatgttaagccaagggcaatgaaaactattctaggtgatcaacgaaaacagatgctccaaaaatacaaagaagaaaagcaacttcaaaaattgaaagagcagagagagaaagctaaacgaggaatatttaaagtgggtcgttatagacctgatatgccttgttttcttttatcaaaccagaatgctgtgaaagctgagccaaaaaaggctattccatcttctgtacggattacaaggtcaaaggccaaagaccaaatggagcagactaagattgataacgagagtgatgttcgagcaatccgacctggtccaagacaaacttctgaaaagaaagtgtcagacaaagagaaaaaagttgtgcagcctgtaatgcccacgtcgttgagaatgactcgatcagctactcaagcagcaaagcaggttcccagaacagtctcatctaccacagcaagaaagccagtcacaagagctgctaatgaaaacgaaccagaaggaaaggtgccaagtaaaggaagacctgccaaaaatgtagaaacaaaacccgacaagggtatttcttgtaaagtcgatagtgaagaaaatactttgaattcacaaactaatgcaacaagtggaatgaatccagatggagtcttatcaaaaatggaaaacttacctgagataaatactgcaaaaataaaagggaagaattcctttgcacctaaggattttatgtttcagccactggatggtctgaagacctatcaagtaacacctatgactcccagaagtgccaatgcttttttgacacccagttacacctggactcctttaaaaacagaagttgatgagtctcaagcaacaaaagaaattttggcacaaaaatgtaaaacttactctaccaagacaatacagcaagattcaaataaattgccatgtcctttgggtcctctaactgtttggcatgaagaacatgttttaaataaaaatgaagctactactaaaaatttaaatggccttccaataaaagaagtcccatcacttgaaagaaatgaaggtcgaattgctcagccccaccatggtgtgccatatttcagaaatatcctccagtcagaaactgagaaattaacttcacattgcttcgagtgggacaggaaacttgaattggacattccagatgatgctaaagatcttattcgcacagcagttggtcaaacaagactccttatgaaggaaaggtttaaacagtttgaaggactggttgatgattgtgaatataaacgaggtataaaggagactacctgtacagatctggatggattttgggatatggttagttttcagatagaagatgtaatccacaaattcaacaatctgatcaaacttgaggaatctgggtggcaagtcaataataatatgaatcataatatgaacaaaaatgtctttaggaaaaaagttgtctcaggtatagcaagtaaaccaaaacaggatgatgctggaagaattgcagcgagaaatcgcctagctgccataaaaaatgcaatgagagagagaattaggcaggaagaatgtgctgaaacagcagtttctgtgataccaaaggaagttgataaaatagtgttcgatgctggatttttcagagttgaaagtcctgttaaattattctcaggactttctgtctcttctgaaggcccttctcaaagacttggaacacctaagtctgtcaacaaagctgtatctcagagtagaaatgagatgggcattccacaacaaactacatcaccagaaaatgccggtcctcagaatacgaaaagtgaacatgtgaagaagactttgtttttgagtattcctgaaagcaggagcagcatagaagatgctcagtgtcctggattaccagatttaattgaagaaaatcatgttgtaaataagacagacttgaaggtggattgtttatccagtgagagaatgagtttgcctcttcttgctggtggagtagcagatgatattaatactaacaaaaaagaaggaatttcagatgttgtggaaggaatggaactgaattcttcaattacatcacaggatgttttgatgagtagccctgaaaaaaatacagcttcacaaaatagcatcttagaagaaggggaaactaaaatttctcagtcagaactatttgataataaaagtctcactactgaatgccaccttcttgattcaccaggtctaaactgcagtaatccatttactcagctggagaggagacatcaagaacatgccagacacatttcttttggtggtaacctgattactttttcacctctacaaccaggagaattttga
Sequence Length
2541
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
94,178 Da
NCBI Official Full Name
Homo sapiens discs, large (Drosophila) homolog-associated protein 5, mRNA
UniProt Protein Name
Disks large-associated protein 5
UniProt Gene Name
DLGAP5
UniProt Synonym Gene Names
DLG7; KIAA0008; DAP-5; HURP
UniProt Entry Name
DLGP5_HUMAN

Uniprot Description

DLG7: a cell cycle regulator that may play a role in carcinogenesis. Elevated levels of expression detected in the G2/M phase of synchronized cultures of HeLa cells. Required for chromosome congression and alignment. Stabilizes mitotic microtubules, promotes microtubule polymerization and controls spindle formation and dynamics Mitotic phosphoprotein regulated by the ubiquitin-proteasome pathway. Interacts with CDC2 and localizes to the spindle poles in mitotic cells. Interacts with the C-terminal proline-rich region of FBXO7. Recruited by FBXO7 to a SCF (SKP1-CUL1-F-box) protein complex in a CDC2/Cyclin B-phosphorylation dependent manner. Colocalizes with E-cadherin (CDH1) at sites of cell-cell contact in intestinal epithelial cells. Key regulator of adherens junction integrity and differentiation that may be involved in CDH1-mediated adhesion and signaling in epithelial cells. Two alternatively spliced isoforms have been described.

Protein type: Cell cycle regulation; Microtubule-binding

Chromosomal Location of Human Ortholog: 14q22.3

Cellular Component: cytoplasm; microtubule organizing center; nucleus; spindle pole centrosome

Molecular Function: phosphoprotein phosphatase activity; protein binding

Similar Products

Product Notes

The DLGAP5 dlgap5 (Catalog #AAA1267730) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcttcat cacattttgc cagtcgacac aggaaggata taagtactga aatgattaga actaaaattg ctcataggaa atcactgtct cagaaagaaa atagacataa ggaatacgaa cgaaatagac actttggttt gaaagatgta aacattccaa ccttggaagg tagaattctt gttgaattag atgagacatc tcaagggctt gttccagaaa agaccaatgt taagccaagg gcaatgaaaa ctattctagg tgatcaacga aaacagatgc tccaaaaata caaagaagaa aagcaacttc aaaaattgaa agagcagaga gagaaagcta aacgaggaat atttaaagtg ggtcgttata gacctgatat gccttgtttt cttttatcaa accagaatgc tgtgaaagct gagccaaaaa aggctattcc atcttctgta cggattacaa ggtcaaaggc caaagaccaa atggagcaga ctaagattga taacgagagt gatgttcgag caatccgacc tggtccaaga caaacttctg aaaagaaagt gtcagacaaa gagaaaaaag ttgtgcagcc tgtaatgccc acgtcgttga gaatgactcg atcagctact caagcagcaa agcaggttcc cagaacagtc tcatctacca cagcaagaaa gccagtcaca agagctgcta atgaaaacga accagaagga aaggtgccaa gtaaaggaag acctgccaaa aatgtagaaa caaaacccga caagggtatt tcttgtaaag tcgatagtga agaaaatact ttgaattcac aaactaatgc aacaagtgga atgaatccag atggagtctt atcaaaaatg gaaaacttac ctgagataaa tactgcaaaa ataaaaggga agaattcctt tgcacctaag gattttatgt ttcagccact ggatggtctg aagacctatc aagtaacacc tatgactccc agaagtgcca atgctttttt gacacccagt tacacctgga ctcctttaaa aacagaagtt gatgagtctc aagcaacaaa agaaattttg gcacaaaaat gtaaaactta ctctaccaag acaatacagc aagattcaaa taaattgcca tgtcctttgg gtcctctaac tgtttggcat gaagaacatg ttttaaataa aaatgaagct actactaaaa atttaaatgg ccttccaata aaagaagtcc catcacttga aagaaatgaa ggtcgaattg ctcagcccca ccatggtgtg ccatatttca gaaatatcct ccagtcagaa actgagaaat taacttcaca ttgcttcgag tgggacagga aacttgaatt ggacattcca gatgatgcta aagatcttat tcgcacagca gttggtcaaa caagactcct tatgaaggaa aggtttaaac agtttgaagg actggttgat gattgtgaat ataaacgagg tataaaggag actacctgta cagatctgga tggattttgg gatatggtta gttttcagat agaagatgta atccacaaat tcaacaatct gatcaaactt gaggaatctg ggtggcaagt caataataat atgaatcata atatgaacaa aaatgtcttt aggaaaaaag ttgtctcagg tatagcaagt aaaccaaaac aggatgatgc tggaagaatt gcagcgagaa atcgcctagc tgccataaaa aatgcaatga gagagagaat taggcaggaa gaatgtgctg aaacagcagt ttctgtgata ccaaaggaag ttgataaaat agtgttcgat gctggatttt tcagagttga aagtcctgtt aaattattct caggactttc tgtctcttct gaaggccctt ctcaaagact tggaacacct aagtctgtca acaaagctgt atctcagagt agaaatgaga tgggcattcc acaacaaact acatcaccag aaaatgccgg tcctcagaat acgaaaagtg aacatgtgaa gaagactttg tttttgagta ttcctgaaag caggagcagc atagaagatg ctcagtgtcc tggattacca gatttaattg aagaaaatca tgttgtaaat aagacagact tgaaggtgga ttgtttatcc agtgagagaa tgagtttgcc tcttcttgct ggtggagtag cagatgatat taatactaac aaaaaagaag gaatttcaga tgttgtggaa ggaatggaac tgaattcttc aattacatca caggatgttt tgatgagtag ccctgaaaaa aatacagctt cacaaaatag catcttagaa gaaggggaaa ctaaaatttc tcagtcagaa ctatttgata ataaaagtct cactactgaa tgccaccttc ttgattcacc aggtctaaac tgcagtaatc catttactca gctggagagg agacatcaag aacatgccag acacatttct tttggtggta acctgattac tttttcacct ctacaaccag gagaattttg a. It is sometimes possible for the material contained within the vial of "DLGAP5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.