Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DIRAS3 cdna clone

DIRAS3 cDNA Clone

Gene Names
DIRAS3; ARHI; NOEY2
Synonyms
DIRAS3; DIRAS3 cDNA Clone; DIRAS3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtaacgccagctttggctccaaggaacagaagctgctgaagcggttgcggcttctgcccgccctgcttatcctccgcgccttcaagccccacaggaagatcagagattaccgcgtcgtggtagtcggcaccgctggtgtggggaaaagtacgctgctgcacaagtgggcgagcggcaacttccgtcatgagtacctgccgaccattgaaaatacctactgccagttgctgggctgcagccacggtgtgctttccctgcacatcaccgacagcaagagtggcgacggcaaccgcgctctgcagcgccacgttatagcccggggccacgccttcgtcctggtctactcagtcaccaagaaggaaaccctggaagagctgaaggccttctatgagctgatctgcaagatcaaaggtaacaacctgcataagttccccatcgtgctggtgggcaataaaagtgatgacacccaccgggaggtggccctgaatgatggtgccacctgtgcgatggagtggaattgcgccttcatggagatttcagccaagaccgatgtgaatgtgcaggagctgttccacatgctgctgaattacaagaaaaagcccaccaccggcctccaggagcccgagaagaaatcccagatgcccaacaccactgagaagctgcttgacaagtgcataatcatgtga
Sequence Length
690
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,861 Da
NCBI Official Full Name
Homo sapiens DIRAS family, GTP-binding RAS-like 3, mRNA
NCBI Official Synonym Full Names
DIRAS family GTPase 3
NCBI Official Symbol
DIRAS3
NCBI Official Synonym Symbols
ARHI; NOEY2
NCBI Protein Information
GTP-binding protein Di-Ras3
UniProt Protein Name
GTP-binding protein Di-Ras3
Protein Family
UniProt Gene Name
DIRAS3
UniProt Synonym Gene Names
ARHI; NOEY2; RHOI
UniProt Entry Name
DIRA3_HUMAN

NCBI Description

This gene encodes a member of the ras superfamily. This gene is imprinted gene with monoallelic expression of the paternal allele which is associated with growth suppression. The encoded protein acts as a tumor suppressor whose function is abrogated in many ovarian and breast cancers. This protein may also play a role autophagy in certain cancer cells by regulating the autophagosome initiation complex. [provided by RefSeq, Nov 2015]

Uniprot Description

DIRAS3: a member of the ras superfamily, and is expressed in normal ovarian and breast epithelial cells, but not in ovarian and breast cancers. It is an imprinted gene, with monoallelic expression of the paternal allele, which is associated with growth suppression. Thus, this gene appears to be a putative tumor suppressor gene whose function is abrogated in ovarian and breast cancers. [provided by RefSeq, Oct 2010]

Protein type: G protein, monomeric, di-Ras; G protein, monomeric; G protein

Chromosomal Location of Human Ortholog: 1p31

Molecular Function: GTPase activity; protein binding

Biological Process: genetic imprinting; regulation of cyclin-dependent protein kinase activity

Research Articles on DIRAS3

Similar Products

Product Notes

The DIRAS3 diras3 (Catalog #AAA1273373) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtaacg ccagctttgg ctccaaggaa cagaagctgc tgaagcggtt gcggcttctg cccgccctgc ttatcctccg cgccttcaag ccccacagga agatcagaga ttaccgcgtc gtggtagtcg gcaccgctgg tgtggggaaa agtacgctgc tgcacaagtg ggcgagcggc aacttccgtc atgagtacct gccgaccatt gaaaatacct actgccagtt gctgggctgc agccacggtg tgctttccct gcacatcacc gacagcaaga gtggcgacgg caaccgcgct ctgcagcgcc acgttatagc ccggggccac gccttcgtcc tggtctactc agtcaccaag aaggaaaccc tggaagagct gaaggccttc tatgagctga tctgcaagat caaaggtaac aacctgcata agttccccat cgtgctggtg ggcaataaaa gtgatgacac ccaccgggag gtggccctga atgatggtgc cacctgtgcg atggagtgga attgcgcctt catggagatt tcagccaaga ccgatgtgaa tgtgcaggag ctgttccaca tgctgctgaa ttacaagaaa aagcccacca ccggcctcca ggagcccgag aagaaatccc agatgcccaa caccactgag aagctgcttg acaagtgcat aatcatgtga. It is sometimes possible for the material contained within the vial of "DIRAS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.