Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DIABLO cdna clone

DIABLO cDNA Clone

Gene Names
DIABLO; SMAC; DFNA64
Synonyms
DIABLO; DIABLO cDNA Clone; DIABLO cdna clone
Ordering
For Research Use Only!
Sequence
atggcggctctgaagagttggctgtcgcgcagcgtaacttcattcttcaggtacagacagtgtttgtgtgttcctgttgtggctaactttaagaagcggtgtttctcagaattgataagaccatggcacaaaactgtgacgattggctttggagtaaccctgtgtgcggttcctattgcacagaaatcagagcctcattcccttagtagtgaagcattgatgaggagagcagtgtctttggtaacagatagcacctctacctttctctctcagaccacatatgcgttgattgaagctattactgaatatactaaggctgtttataccttaacttctctttaccgacaatatacaagtttacttgggaaaatgaattcagaggaggaagatgaagtgtggcaggtgatcataggagccagagctgagatgacttcaaaacaccaagagtacttgaagctggaaaccacttggatgactgcagttggtctttcagagatggcagcagaagctgcatatcaaactggcgcagatcaggcctctataaccgccaggaatcacattcagctggtgaaactgcaggtggaagaggtgcaccagctctcccggaaagcagaaaccaagctggcagaagcacagatagaagagctccgtcagaaaacacaggaggaaggggaggagcgggctgagtcggagcaggaggcctacctgcgtgaggattga
Sequence Length
720
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,284 Da
NCBI Official Full Name
Homo sapiens diablo homolog (Drosophila), mRNA
NCBI Official Synonym Full Names
diablo IAP-binding mitochondrial protein
NCBI Official Symbol
DIABLO
NCBI Official Synonym Symbols
SMAC; DFNA64
NCBI Protein Information
diablo homolog, mitochondrial
UniProt Protein Name
Diablo homolog, mitochondrial
Protein Family
UniProt Gene Name
DIABLO
UniProt Synonym Gene Names
SMAC; Smac
UniProt Entry Name
DBLOH_HUMAN

NCBI Description

This gene encodes an inhibitor of apoptosis protein (IAP)-binding protein. The encoded mitochondrial protein enters the cytosol when cells undergo apoptosis, and allows activation of caspases by binding to inhibitor of apoptosis proteins. Overexpression of the encoded protein sensitizes tumor cells to apoptosis. A mutation in this gene is associated with young-adult onset of nonsyndromic deafness-64. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]

Uniprot Description

DIABLO: Promotes apoptosis by activating caspases in the cytochrome c/Apaf-1/caspase-9 pathway. Acts by opposing the inhibitory activity of inhibitor of apoptosis proteins (IAP). Inhibits the activity of BIRC6/bruce by inhibiting its binding to caspases. Isoform 3 attenuates the stability and apoptosis- inhibiting activity of XIAP/BIRC4 by promoting XIAP/BIRC4 ubiquitination and degradation through the ubiquitin-proteasome pathway. Isoform 3 also disrupts XIAP/BIRC4 interacting with processed caspase-9 and promotes caspase-3 activation. Isoform 1 is defective in the capacity to down-regulate the XIAP/BIRC4 abundance. Homodimer. Interacts with NGFRAP1/BEX3. Interacts with BIRC2/c-IAP1, BIRC3/c-IAP2, XIAP/BIRC4, BIRC6/bruce and BIRC7/livin. Interacts with the monomeric and dimeric form of BIRC5/survivin. Ubiquitously expressed with highest expression in testis. Expression is also high in heart, liver, kidney, spleen, prostate and ovary. Low in brain, lung, thymus and peripheral blood leukocytes. Isoform 3 is ubiquitously expressed. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Apoptosis; Mitochondrial

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: cytosol; internal side of plasma membrane; mitochondrial intermembrane space; mitochondrion

Molecular Function: protein binding

Biological Process: apoptosis; caspase activation; induction of apoptosis via death domain receptors; positive regulation of apoptosis

Disease: Deafness, Autosomal Dominant 64

Research Articles on DIABLO

Similar Products

Product Notes

The DIABLO diablo (Catalog #AAA1278149) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggctc tgaagagttg gctgtcgcgc agcgtaactt cattcttcag gtacagacag tgtttgtgtg ttcctgttgt ggctaacttt aagaagcggt gtttctcaga attgataaga ccatggcaca aaactgtgac gattggcttt ggagtaaccc tgtgtgcggt tcctattgca cagaaatcag agcctcattc ccttagtagt gaagcattga tgaggagagc agtgtctttg gtaacagata gcacctctac ctttctctct cagaccacat atgcgttgat tgaagctatt actgaatata ctaaggctgt ttatacctta acttctcttt accgacaata tacaagttta cttgggaaaa tgaattcaga ggaggaagat gaagtgtggc aggtgatcat aggagccaga gctgagatga cttcaaaaca ccaagagtac ttgaagctgg aaaccacttg gatgactgca gttggtcttt cagagatggc agcagaagct gcatatcaaa ctggcgcaga tcaggcctct ataaccgcca ggaatcacat tcagctggtg aaactgcagg tggaagaggt gcaccagctc tcccggaaag cagaaaccaa gctggcagaa gcacagatag aagagctccg tcagaaaaca caggaggaag gggaggagcg ggctgagtcg gagcaggagg cctacctgcg tgaggattga. It is sometimes possible for the material contained within the vial of "DIABLO, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.