Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHX37 cdna clone

DHX37 cDNA Clone

Gene Names
DHX37; DDX37
Synonyms
DHX37; DHX37 cDNA Clone; DHX37 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcttcgtggcctgctctcaggaagtgggtcaagccctgggaaccctcatccatgagagctcgatcccgtatgaagggtgctgccgcccgtgccatctggcccgggggtga
Sequence Length
114
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
129,545 Da
NCBI Official Full Name
Homo sapiens DEAH (Asp-Glu-Ala-His) box polypeptide 37, mRNA
NCBI Official Synonym Full Names
DEAH-box helicase 37
NCBI Official Symbol
DHX37
NCBI Official Synonym Symbols
DDX37
NCBI Protein Information
probable ATP-dependent RNA helicase DHX37
UniProt Protein Name
Probable ATP-dependent RNA helicase DHX37
UniProt Gene Name
DHX37
UniProt Synonym Gene Names
DDX37; KIAA1517
UniProt Entry Name
DHX37_HUMAN

NCBI Description

This gene encodes a DEAD box protein. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. [provided by RefSeq, Jul 2008]

Uniprot Description

DHX37: a DEAD box protein. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. [provided by RefSeq, Jul 2008]

Protein type: EC 3.6.4.13; Helicase

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: cytoplasm; nucleolus; nucleoplasm

Molecular Function: ATP-dependent RNA helicase activity

Biological Process: RNA processing; rRNA processing

Similar Products

Product Notes

The DHX37 dhx37 (Catalog #AAA1265773) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcttcg tggcctgctc tcaggaagtg ggtcaagccc tgggaaccct catccatgag agctcgatcc cgtatgaagg gtgctgccgc ccgtgccatc tggcccgggg gtga. It is sometimes possible for the material contained within the vial of "DHX37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.