Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DHDDS cdna clone

DHDDS cDNA Clone

Gene Names
DHDDS; DS; CIT; CPT; HDS; RP59
Synonyms
DHDDS; DHDDS cDNA Clone; DHDDS cdna clone
Ordering
For Research Use Only!
Sequence
atgtcatggatcaaggaaggagagctgtcactttgggagcggttctgtgccaacatcataaaggcaggcccaatgccgaaacacattgcattcataatggacgggaaccgtcgctatgccaagaagtgccaggtggagcggcaggaaggccactcacagggcttcaacaagctagctgagactctgcggtggtgtttgaacctgggcatcctagaggtgacagtctacgcattcagcattgagaacttcaaacgctccaagagtgaggtagacgggcttatggatctggcccggcagaagttcagccgcttgatggaagaaaagtgtttcctgaatgtctgttttgcatacacatcccgtcatgagatcagcaatgctgtgagagagatggcctggggggtggagcaaggcctgttggatcccagtgatatctctgagtctctgcttgataagtgcctctataccaaccgctctcctcatcctgacatcttgatacggacttctggagaagtgcggctgagtgacttcttgctatggcagacctctcactcctgcctggtgttccaacccgttctgtggccagagtatacattttggaacctcttcgaggccatcctgcagttccagatgaaccatagcgtgcttcagaaggcccgagacatgtatgcagaggagcggaagaggcagcagctggagagggaccaggctacagtgacagagcagctgctgcgagaggggctccaagccagtggggacgcccagctccgaaggacacgcttgcacaaactctcggccagacgggaagagcgagtccaaggcttcctgcaggccttggaactcaagcgagctgactggctggcccgtctgggcactgcatcagcctga
Sequence Length
885
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,817 Da
NCBI Official Full Name
Homo sapiens dehydrodolichyl diphosphate synthase, mRNA
NCBI Official Synonym Full Names
dehydrodolichyl diphosphate synthase subunit
NCBI Official Symbol
DHDDS
NCBI Official Synonym Symbols
DS; CIT; CPT; HDS; RP59
NCBI Protein Information
dehydrodolichyl diphosphate synthase complex subunit DHDDS
UniProt Protein Name
Dehydrodolichyl diphosphate synthase complex subunit DHDDS
UniProt Gene Name
DHDDS
UniProt Synonym Gene Names
HDS; CIT; Cis-IPTase
UniProt Entry Name
DHDDS_HUMAN

NCBI Description

The protein encoded by this gene catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier lipid required for the biosynthesis of several classes of glycoproteins. Mutations in this gene are associated with retinitis pigmentosa type 59. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]

Uniprot Description

DHDDS: Catalyzes cis-prenyl chain elongation to produce the polyprenyl backbone of dolichol, a glycosyl carrier-lipid required for the biosynthesis of several classes of glycoprotein. Defects in DHDDS are the cause of retinitis pigmentosa type 59 (RP59). RP59 is a retinal dystrophy belonging to the group of pigmentary retinopathies. Retinitis pigmentosa is characterized by retinal pigment deposits visible on fundus examination and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. Belongs to the UPP synthase family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; EC 2.5.1.87; Secondary Metabolites Metabolism - terpenoid backbone biosynthesis

Chromosomal Location of Human Ortholog: 1p36.11

Cellular Component: endoplasmic reticulum membrane

Molecular Function: polyprenyltransferase activity; protein binding

Biological Process: dolichyl diphosphate biosynthetic process

Disease: Retinitis Pigmentosa 59

Research Articles on DHDDS

Similar Products

Product Notes

The DHDDS dhdds (Catalog #AAA1265691) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcatgga tcaaggaagg agagctgtca ctttgggagc ggttctgtgc caacatcata aaggcaggcc caatgccgaa acacattgca ttcataatgg acgggaaccg tcgctatgcc aagaagtgcc aggtggagcg gcaggaaggc cactcacagg gcttcaacaa gctagctgag actctgcggt ggtgtttgaa cctgggcatc ctagaggtga cagtctacgc attcagcatt gagaacttca aacgctccaa gagtgaggta gacgggctta tggatctggc ccggcagaag ttcagccgct tgatggaaga aaagtgtttc ctgaatgtct gttttgcata cacatcccgt catgagatca gcaatgctgt gagagagatg gcctgggggg tggagcaagg cctgttggat cccagtgata tctctgagtc tctgcttgat aagtgcctct ataccaaccg ctctcctcat cctgacatct tgatacggac ttctggagaa gtgcggctga gtgacttctt gctatggcag acctctcact cctgcctggt gttccaaccc gttctgtggc cagagtatac attttggaac ctcttcgagg ccatcctgca gttccagatg aaccatagcg tgcttcagaa ggcccgagac atgtatgcag aggagcggaa gaggcagcag ctggagaggg accaggctac agtgacagag cagctgctgc gagaggggct ccaagccagt ggggacgccc agctccgaag gacacgcttg cacaaactct cggccagacg ggaagagcga gtccaaggct tcctgcaggc cttggaactc aagcgagctg actggctggc ccgtctgggc actgcatcag cctga. It is sometimes possible for the material contained within the vial of "DHDDS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.