Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DGUOK cdna clone

DGUOK cDNA Clone

Gene Names
DGUOK; dGK; NCPH; PEOB4; MTDPS3
Synonyms
DGUOK; DGUOK cDNA Clone; DGUOK cdna clone
Ordering
For Research Use Only!
Sequence
atgatgtaccgggagccagcacgatggtcctacacattccagacattttcctttttgagccgcctgaaagtacagctggagcccttccctgagaaactcttacaggccaggaagccagtacagatctttgagaggtctgtgtacagtgacaggctccactttgaggctctgatgaacattccagtgctggtgttggatgtcaatgatgatttttctgaggaagtaaccaaacaagaagacctcatgagagaggtaaacacctttgtaaagaatctgtaa
Sequence Length
279
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,442 Da
NCBI Official Full Name
Homo sapiens deoxyguanosine kinase, mRNA
NCBI Official Synonym Full Names
deoxyguanosine kinase
NCBI Official Symbol
DGUOK
NCBI Official Synonym Symbols
dGK; NCPH; PEOB4; MTDPS3
NCBI Protein Information
deoxyguanosine kinase, mitochondrial
UniProt Protein Name
Deoxyguanosine kinase, mitochondrial
UniProt Gene Name
DGUOK
UniProt Synonym Gene Names
DGK; dGK
UniProt Entry Name
DGUOK_HUMAN

NCBI Description

In mammalian cells, the phosphorylation of purine deoxyribonucleosides is mediated predominantly by two deoxyribonucleoside kinases, cytosolic deoxycytidine kinase and mitochondrial deoxyguanosine kinase. The protein encoded by this gene is responsible for phosphorylation of purine deoxyribonucleosides in the mitochondrial matrix. In addition, this protein phosphorylates several purine deoxyribonucleoside analogs used in the treatment of lymphoproliferative disorders, and this phosphorylation is critical for the effectiveness of the analogs. Alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

DGUOK: Required for the phosphorylation of several deoxyribonucleosides and certain nucleoside analogs widely employed as antiviral and chemotherapeutic agents. Defects in DGUOK are the cause of mitochondrial DNA depletion syndrome type 3 (MTDPS3). A disorder characterized by onset in infancy of progressive liver failure, hypoglycemia, increased lactate in body fluids, and neurologic abnormalities including hypotonia, encephalopathy, peripheral neuropathy. Affected tissues show both decreased activity of the mtDNA-encoded respiratory chain complexes and mtDNA depletion. Belongs to the DCK/DGK family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleotide Metabolism - purine; Kinase, other; EC 2.7.1.113; Mitochondrial

Chromosomal Location of Human Ortholog: 2p13

Cellular Component: mitochondrial matrix; mitochondrion; nucleus

Molecular Function: deoxyguanosine kinase activity; nucleoside kinase activity

Biological Process: guanosine metabolic process; purine deoxyribonucleoside metabolic process; purine salvage

Disease: Mitochondrial Dna Depletion Syndrome 3 (hepatocerebral Type)

Research Articles on DGUOK

Similar Products

Product Notes

The DGUOK dguok (Catalog #AAA1269550) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgtacc gggagccagc acgatggtcc tacacattcc agacattttc ctttttgagc cgcctgaaag tacagctgga gcccttccct gagaaactct tacaggccag gaagccagta cagatctttg agaggtctgt gtacagtgac aggctccact ttgaggctct gatgaacatt ccagtgctgg tgttggatgt caatgatgat ttttctgagg aagtaaccaa acaagaagac ctcatgagag aggtaaacac ctttgtaaag aatctgtaa. It is sometimes possible for the material contained within the vial of "DGUOK, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.