DEPDC1B cdna clone
DEPDC1B cDNA Clone
Gene Names
DEPDC1B; XTP1; BRCC3
Synonyms
DEPDC1B; DEPDC1B cDNA Clone; DEPDC1B cdna clone
Sequence
atggagcatcgcatcgtggggcccgggccgtaccgagctaccaggctgtggaatgagaccgtggagctttttcgtgctaagatgccgttacggaaacatcgctgtcgtttcaagagctatgagcattgtttcacagcggccgaagctgtggattggctgcatgagctgctgaggtgcagtcaaaacttcggccctgaagtgacccgcaaacaaacggtccagctgctaaaaaaattcctgaagaatcacgttattgaagacatcaagggaaaatggggtgaggaagattttgaagacaatcgtcacttatacagatttcctccttcttcacccctgaaaccatatccaaagaagcccccaaaccaaaaggatgttattaaatttccagaatggaatgatctcccaccaggcacttcacaagagaacatcccagtgaggccagttgtgatgaattctgagatgtggtacaagcgtcacagtattgcaattggagaggtgccagcttgccgtcttgtccaccgcagacagctgacagaggccaatgtagaagagatatggaagtctatgacattatcatacttacagaaaattcttggcctggattccttagaagaagttttagacgtcaaacttgtcaattcgaagttcatcatccataatgtatatagtgttagcaagcagggagttgttattcttgatgacaagtcaaaagaacttcctcattgggtgctgtcagctatgaagtgtttggcaaattggcccaactgttctgatttgaagcagcctatgtacttgggatttgaaaaagatgtctttaaaaccatagctgattactatggtcacttgaaagagcctctacttacatttcatctttttgatgcttttgtcagtgtactgggtttgttacagaaggagaaagtggcagttgaagcatttcagatttgctgccttctcctacctcctgaaaataggagaaagttacagctattgatgatgatgatggcaaggatttgcttaaacaaagagatgccacccctgtgtgatggctttggtacccgaacactgatggttcagacattttcccgttgcatcttgtgttccaaggatgaagtggacttggatgagttattagctgctagattggtaacgtttctgatggacaattaccaggaaattctgaaactccctttggccttgcagacctctatagaggagcgtgtggctcatctacgaagagtccagataaaatacccaggagctgatatggatatcactttatctgctccatcattttgccgtcaaattagtccagaggaatttgaatatcaaagatcatatggctctcaggaacctctggcagccttgttggaggaagtcataacagatgccaaactctccaacaaagagaaaaagaagaaactgaagcagtttcagaaatcctatcctgaagtctatcaagaacgatttcctacaccagaaagtgcagcacttctgtttcctgaaaaacccaaaccgaaaccacagctgctaatgtgggcactaaagaagcctttccaaccatttcaaagaactagaagttttcgaatgtaa
Sequence Length
1590
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
54,726 Da
NCBI Official Full Name
Homo sapiens DEP domain containing 1B, mRNA
NCBI Official Synonym Full Names
DEP domain containing 1B
NCBI Official Symbol
DEPDC1B
NCBI Official Synonym Symbols
XTP1; BRCC3
NCBI Protein Information
DEP domain-containing protein 1B
UniProt Protein Name
DEP domain-containing protein 1B
Protein Family
UniProt Gene Name
DEPDC1B
UniProt Synonym Gene Names
XTP8
UniProt Entry Name
DEP1B_HUMAN
Uniprot Description
DEPDC1B: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: GAPs; GAPs, Rac/Rho
Chromosomal Location of Human Ortholog: 5q12.1
Cellular Component: cytosol
Molecular Function: GTPase activator activity
Biological Process: cell migration; positive regulation of Wnt receptor signaling pathway; regulation of small GTPase mediated signal transduction
Research Articles on DEPDC1B
Similar Products
Product Notes
The DEPDC1B depdc1b (Catalog #AAA1272267) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcatc gcatcgtggg gcccgggccg taccgagcta ccaggctgtg gaatgagacc gtggagcttt ttcgtgctaa gatgccgtta cggaaacatc gctgtcgttt caagagctat gagcattgtt tcacagcggc cgaagctgtg gattggctgc atgagctgct gaggtgcagt caaaacttcg gccctgaagt gacccgcaaa caaacggtcc agctgctaaa aaaattcctg aagaatcacg ttattgaaga catcaaggga aaatggggtg aggaagattt tgaagacaat cgtcacttat acagatttcc tccttcttca cccctgaaac catatccaaa gaagccccca aaccaaaagg atgttattaa atttccagaa tggaatgatc tcccaccagg cacttcacaa gagaacatcc cagtgaggcc agttgtgatg aattctgaga tgtggtacaa gcgtcacagt attgcaattg gagaggtgcc agcttgccgt cttgtccacc gcagacagct gacagaggcc aatgtagaag agatatggaa gtctatgaca ttatcatact tacagaaaat tcttggcctg gattccttag aagaagtttt agacgtcaaa cttgtcaatt cgaagttcat catccataat gtatatagtg ttagcaagca gggagttgtt attcttgatg acaagtcaaa agaacttcct cattgggtgc tgtcagctat gaagtgtttg gcaaattggc ccaactgttc tgatttgaag cagcctatgt acttgggatt tgaaaaagat gtctttaaaa ccatagctga ttactatggt cacttgaaag agcctctact tacatttcat ctttttgatg cttttgtcag tgtactgggt ttgttacaga aggagaaagt ggcagttgaa gcatttcaga tttgctgcct tctcctacct cctgaaaata ggagaaagtt acagctattg atgatgatga tggcaaggat ttgcttaaac aaagagatgc cacccctgtg tgatggcttt ggtacccgaa cactgatggt tcagacattt tcccgttgca tcttgtgttc caaggatgaa gtggacttgg atgagttatt agctgctaga ttggtaacgt ttctgatgga caattaccag gaaattctga aactcccttt ggccttgcag acctctatag aggagcgtgt ggctcatcta cgaagagtcc agataaaata cccaggagct gatatggata tcactttatc tgctccatca ttttgccgtc aaattagtcc agaggaattt gaatatcaaa gatcatatgg ctctcaggaa cctctggcag ccttgttgga ggaagtcata acagatgcca aactctccaa caaagagaaa aagaagaaac tgaagcagtt tcagaaatcc tatcctgaag tctatcaaga acgatttcct acaccagaaa gtgcagcact tctgtttcct gaaaaaccca aaccgaaacc acagctgcta atgtgggcac taaagaagcc tttccaacca tttcaaagaa ctagaagttt tcgaatgtaa. It is sometimes possible for the material contained within the vial of "DEPDC1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
