Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DEGS1 cdna clone

DEGS1 cDNA Clone

Gene Names
DEGS1; MLD; DEGS; DES1; Des-1; FADS7; MIG15; DEGS-1
Synonyms
DEGS1; DEGS1 cDNA Clone; DEGS1 cdna clone
Ordering
For Research Use Only!
Sequence
atggggagccgcgtctcgcgggaagacttcgagtgggtctacaccgaccagccgcacgccgaccggcgccgggagatcctggcaaagtatccagagataaagtccttgatgaaacctgatcccaatttgatatggattataattatgatggttctcacccagttgggtgcattttacatagtaaaagacttggactggaaatgggtcatatttggggcctatgcgtttggcagttgcattaaccactcaatgactctggctattcatgagattgcccacaatgctgcctttggcaactgcaaagcaatgtggaatcgctggtttggaatgtttgctaatcttcctattgggattccatattcaatttcctttaagaggtatcacatggatcatcatcggtaccttggagctgatggcgtcgatgtagatattcctaccgattttgagggctggttcttctgtaccgctttcagaaagtttatatgggttattcttcagcctctcttttatgcctttcgacctctgttcatcaaccccaaaccaattacgtatctggaagttatcaataccgtggcacaggtcacttttgacattttaatttattactttttgggaattaaatccttagtctacatgttggcagcatctttacttggcctgggtttgcacccaatttctggacattttatagctgagcattacatgttcttaaagggtcatgaaacttactcatattatgggcctctgaatttacttaccttcaatgtgggttatcataatgaacatcatgatttccccaacattcctggaaaaagtcttccactggtgaggaaaatagcagctgaatactatgacaacctccctcactacaattcctggataaaagtactgtatgattttgtgatggatgatacaataagtccctactcaagaatgaagaggcaccaaaaaggagagatggtgctggagtaa
Sequence Length
972
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,866 Da
NCBI Official Full Name
Homo sapiens degenerative spermatocyte homolog 1, lipid desaturase (Drosophila), mRNA
NCBI Official Synonym Full Names
delta 4-desaturase, sphingolipid 1
NCBI Official Symbol
DEGS1
NCBI Official Synonym Symbols
MLD; DEGS; DES1; Des-1; FADS7; MIG15; DEGS-1
NCBI Protein Information
sphingolipid delta(4)-desaturase DES1
UniProt Protein Name
Sphingolipid delta(4)-desaturase DES1
UniProt Gene Name
DEGS1
UniProt Synonym Gene Names
DES1; MLD
UniProt Entry Name
DEGS1_HUMAN

NCBI Description

This gene encodes a member of the membrane fatty acid desaturase family which is responsible for inserting double bonds into specific positions in fatty acids. This protein contains three His-containing consensus motifs that are characteristic of a group of membrane fatty acid desaturases. It is predicted to be a multiple membrane-spanning protein localized to the endoplasmic reticulum. Overexpression of this gene inhibited biosynthesis of the EGF receptor, suggesting a possible role of a fatty acid desaturase in regulating biosynthetic processing of the EGF receptor. [provided by RefSeq, Mar 2010]

Uniprot Description

DEGS1: Has sphingolipid-delta-4-desaturase activity. Converts D-erythro-sphinganine to D-erythro-sphingosine (E-sphing-4-enine). Belongs to the fatty acid desaturase family. DEGS subfamily.

Protein type: Lipid Metabolism - sphingolipid; Oxidoreductase; Membrane protein, multi-pass; Membrane protein, integral; EC 1.14.-.-

Chromosomal Location of Human Ortholog: 1q42.11

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; integral to plasma membrane; membrane

Molecular Function: electron carrier activity; sphingolipid delta-4 desaturase activity

Biological Process: ceramide biosynthetic process; sphingolipid biosynthetic process; unsaturated fatty acid biosynthetic process

Research Articles on DEGS1

Similar Products

Product Notes

The DEGS1 degs1 (Catalog #AAA1278103) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggagcc gcgtctcgcg ggaagacttc gagtgggtct acaccgacca gccgcacgcc gaccggcgcc gggagatcct ggcaaagtat ccagagataa agtccttgat gaaacctgat cccaatttga tatggattat aattatgatg gttctcaccc agttgggtgc attttacata gtaaaagact tggactggaa atgggtcata tttggggcct atgcgtttgg cagttgcatt aaccactcaa tgactctggc tattcatgag attgcccaca atgctgcctt tggcaactgc aaagcaatgt ggaatcgctg gtttggaatg tttgctaatc ttcctattgg gattccatat tcaatttcct ttaagaggta tcacatggat catcatcggt accttggagc tgatggcgtc gatgtagata ttcctaccga ttttgagggc tggttcttct gtaccgcttt cagaaagttt atatgggtta ttcttcagcc tctcttttat gcctttcgac ctctgttcat caaccccaaa ccaattacgt atctggaagt tatcaatacc gtggcacagg tcacttttga cattttaatt tattactttt tgggaattaa atccttagtc tacatgttgg cagcatcttt acttggcctg ggtttgcacc caatttctgg acattttata gctgagcatt acatgttctt aaagggtcat gaaacttact catattatgg gcctctgaat ttacttacct tcaatgtggg ttatcataat gaacatcatg atttccccaa cattcctgga aaaagtcttc cactggtgag gaaaatagca gctgaatact atgacaacct ccctcactac aattcctgga taaaagtact gtatgatttt gtgatggatg atacaataag tccctactca agaatgaaga ggcaccaaaa aggagagatg gtgctggagt aa. It is sometimes possible for the material contained within the vial of "DEGS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.