Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX6 cdna clone

DDX6 cDNA Clone

Gene Names
DDX6; P54; RCK; HLR2
Synonyms
DDX6; DDX6 cDNA Clone; DDX6 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcacggccagaacagagaaccctgttataatgggtctgtccagtcaaaatggtcagctgagaggccctgtgaaacccactggtggccctggaggagggggcacacagacacagcaacagatgaaccagctgaaaaacaccaacacaatcaataatggcactcagcagcaagcacagagtatgaccaccactattaaacctggtgatgactggaaaaagactttaaaactccctccaaaggatctaagaatcaaaacttcggatgtgacctccacaaaaggaaatgagtttgaagattactgtttgaaacgggagttactgatgggaatttttgaaatgggctgggaaaagccatctcctattcaggaggagagcattcccattgctttatctggtagggatatcttagctagagcaaaaaatggaacaggcaagagcggtgcctacctcattcccttacttgaacggctagacctgaagaaggacaatatacaagcaatggtgattgttcccactagagaacttgctctacaggtcagtcaaatttgcatccaggtcagcaaacacatgggaggggccaaagtgatggcaaccacaggaggaaccaatttacgagatgacataatgaggcttgatgatacagtgcacgtggtgattgctacccctgggagaatcctggatcttattaagaaaggagtagcaaaggttgatcatgtccagatgatagtattggatgaggcagataagttgctgtcacaggattttgtgcagataatggaggatattattctcacgctacctaaaaacaggcagattttactatattccgctactttccctcttagtgtacagaagttcatgaattcccatttgcagaaaccctatgagattaacctgatggaggaactaactctgaagggagtaacccagtactacgcatatgtaactgagcgccaaaaagtacactgcctcaacacacttttctccaggcttcagataaaccagtcgatcattttctgtaactcctctcagcgagttgaattgctagccaagaagatttctcaactgggttattcttgcttctatattcatgctaaaatgaggcaggaacatcgaaatcgtgtatttcatgatttccgaaatggcttatgccgcaatcttgtttgcactgatctgtttacccgaggtattgatatacaagctgtgaatgtggtaataaactttgatttcccaaagctggcagagacctatctccatcgtattggaagatcaggtcgctttggtcatcttggcttagccatcaacttgatcacatatgatgatcgcttcaacctgaaaagtattgaggagcagctgggaacagaaattaaacctattccgagcaacattgataagagcctgtatgtggcagaataccacagcgagcctgtagaagatgagaaaccttaa
Sequence Length
1452
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
54,417 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 6, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 6
NCBI Official Symbol
DDX6
NCBI Official Synonym Symbols
P54; RCK; HLR2
NCBI Protein Information
probable ATP-dependent RNA helicase DDX6
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX6
UniProt Gene Name
DDX6
UniProt Synonym Gene Names
HLR2; RCK
UniProt Entry Name
DDX6_HUMAN

NCBI Description

This gene encodes a member of the DEAD box protein family. The protein is an RNA helicase found in P-bodies and stress granules, and functions in translation suppression and mRNA degradation. It is required for microRNA-induced gene silencing. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Mar 2012]

Uniprot Description

DDX6: an oncogenic ATP-dependent helicase of the DEAD box family. Interacts with argonaute proteins, Ago1 and Ago2, and is a general repressor of translation in human cells by miRNA-induced gene silencing. In the process of mRNA degradation, may play a role in mRNA decapping.

Protein type: EC 3.6.4.13; RNA-binding; Oncoprotein; Helicase; RNA processing

Chromosomal Location of Human Ortholog: 11q23.3

Cellular Component: cell-cell adherens junction; cytoplasm; cytosol; intracellular membrane-bound organelle; membrane; stress granule

Molecular Function: ATP-dependent RNA helicase activity; helicase activity; protein binding; protein domain specific binding; RNA helicase activity

Biological Process: cytoplasmic mRNA processing body assembly; regulation of translation; RNA secondary structure unwinding; viral RNA genome packaging

Research Articles on DDX6

Similar Products

Product Notes

The DDX6 ddx6 (Catalog #AAA1277181) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcacgg ccagaacaga gaaccctgtt ataatgggtc tgtccagtca aaatggtcag ctgagaggcc ctgtgaaacc cactggtggc cctggaggag ggggcacaca gacacagcaa cagatgaacc agctgaaaaa caccaacaca atcaataatg gcactcagca gcaagcacag agtatgacca ccactattaa acctggtgat gactggaaaa agactttaaa actccctcca aaggatctaa gaatcaaaac ttcggatgtg acctccacaa aaggaaatga gtttgaagat tactgtttga aacgggagtt actgatggga atttttgaaa tgggctggga aaagccatct cctattcagg aggagagcat tcccattgct ttatctggta gggatatctt agctagagca aaaaatggaa caggcaagag cggtgcctac ctcattccct tacttgaacg gctagacctg aagaaggaca atatacaagc aatggtgatt gttcccacta gagaacttgc tctacaggtc agtcaaattt gcatccaggt cagcaaacac atgggagggg ccaaagtgat ggcaaccaca ggaggaacca atttacgaga tgacataatg aggcttgatg atacagtgca cgtggtgatt gctacccctg ggagaatcct ggatcttatt aagaaaggag tagcaaaggt tgatcatgtc cagatgatag tattggatga ggcagataag ttgctgtcac aggattttgt gcagataatg gaggatatta ttctcacgct acctaaaaac aggcagattt tactatattc cgctactttc cctcttagtg tacagaagtt catgaattcc catttgcaga aaccctatga gattaacctg atggaggaac taactctgaa gggagtaacc cagtactacg catatgtaac tgagcgccaa aaagtacact gcctcaacac acttttctcc aggcttcaga taaaccagtc gatcattttc tgtaactcct ctcagcgagt tgaattgcta gccaagaaga tttctcaact gggttattct tgcttctata ttcatgctaa aatgaggcag gaacatcgaa atcgtgtatt tcatgatttc cgaaatggct tatgccgcaa tcttgtttgc actgatctgt ttacccgagg tattgatata caagctgtga atgtggtaat aaactttgat ttcccaaagc tggcagagac ctatctccat cgtattggaa gatcaggtcg ctttggtcat cttggcttag ccatcaactt gatcacatat gatgatcgct tcaacctgaa aagtattgag gagcagctgg gaacagaaat taaacctatt ccgagcaaca ttgataagag cctgtatgtg gcagaatacc acagcgagcc tgtagaagat gagaaacctt aa. It is sometimes possible for the material contained within the vial of "DDX6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.