Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX54 cdna clone

DDX54 cDNA Clone

Gene Names
DDX54; DP97
Synonyms
DDX54; DDX54 cDNA Clone; DDX54 cdna clone
Ordering
For Research Use Only!
Sequence
atgcacctcggatgtggagccggacacccgggagatggtgcgtgcccagaacaagaagaagaagaagtctggaggcttccagtccatgggcctgagctacccggtgttcaaaggcatcatgaagaagggggagcctttgagcagcaggcagctggcgctgtcctggacttgatgggggatgaagcccagaacctgacgaggggccggcagcagctcaagtgggaccgtaagaagaagcggtttgtgggacagtcaggacaggaagacaagaagaagattaagacagagagcggccgctacatcagcagctcctacaagcgagacctctatcagaagtggaaacagaaacagaaaattgatgatcgtgactcggacgaagaaggggcatctgaccggcgaggcccagagcgaagaggtgggaagcgagaccgtggccaagcaggtgcatcccggccccacgccccaggcacccctgcaggccgagtccgcccggaactcaagaccaagcagcagatcctgaagcagcggcgccgggcccagaagctgcacttcctgcagcgtggtggcctcaagcagctctctgcccgcaaccgccgccgcgtccaggagctgcagcagggcgccttcggccggggtgcccgctccaagaagggcaagatgcggaagaggatgtga
Sequence Length
675
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
98,666 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 54, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 54
NCBI Official Symbol
DDX54
NCBI Official Synonym Symbols
DP97
NCBI Protein Information
ATP-dependent RNA helicase DDX54
UniProt Protein Name
ATP-dependent RNA helicase DDX54
UniProt Gene Name
DDX54
UniProt Entry Name
DDX54_HUMAN

NCBI Description

This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The nucleolar protein encoded by this gene interacts in a hormone-dependent manner with nuclear receptors, and represses their transcriptional activity. Alternative splice variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX54: Has RNA-dependent ATPase activity. Represses the transcriptional activity of nuclear receptors. Belongs to the DEAD box helicase family. DDX54/DBP10 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Helicase; Nuclear receptor co-regulator; RNA processing; Nucleolus; Transcription, coactivator/corepressor; EC 3.6.4.13

Chromosomal Location of Human Ortholog: 12q24.13

Cellular Component: membrane; nucleolus; nucleus

Molecular Function: ATP-dependent RNA helicase activity; estrogen receptor binding; receptor binding; transcription corepressor activity

Biological Process: estrogen receptor signaling pathway; RNA metabolic process; RNA processing; RNA secondary structure unwinding

Research Articles on DDX54

Similar Products

Product Notes

The DDX54 ddx54 (Catalog #AAA1266569) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacctcg gatgtggagc cggacacccg ggagatggtg cgtgcccaga acaagaagaa gaagaagtct ggaggcttcc agtccatggg cctgagctac ccggtgttca aaggcatcat gaagaagggg gagcctttga gcagcaggca gctggcgctg tcctggactt gatgggggat gaagcccaga acctgacgag gggccggcag cagctcaagt gggaccgtaa gaagaagcgg tttgtgggac agtcaggaca ggaagacaag aagaagatta agacagagag cggccgctac atcagcagct cctacaagcg agacctctat cagaagtgga aacagaaaca gaaaattgat gatcgtgact cggacgaaga aggggcatct gaccggcgag gcccagagcg aagaggtggg aagcgagacc gtggccaagc aggtgcatcc cggccccacg ccccaggcac ccctgcaggc cgagtccgcc cggaactcaa gaccaagcag cagatcctga agcagcggcg ccgggcccag aagctgcact tcctgcagcg tggtggcctc aagcagctct ctgcccgcaa ccgccgccgc gtccaggagc tgcagcaggg cgccttcggc cggggtgccc gctccaagaa gggcaagatg cggaagagga tgtga. It is sometimes possible for the material contained within the vial of "DDX54, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.