Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX25 cdna clone

DDX25 cDNA Clone

Gene Names
DDX25; GRTH
Synonyms
DDX25; DDX25 cDNA Clone; DDX25 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgtcgttactgtggggaggcgacgcaggggcggcggagagcgagcggctgaacagccacttttcaaacctcagccaaccccggaagaacctttggggtattaagagtactgcagtccgaaacatagatggttctattaataacatcaatgaagatgatgaagaagatgtagtggatttggcagctaattcactcttaaacaagttaatccatcaatccttagtagaatccagtcaccgtgtggaagttttacagaaggatcccagctctccactttactcagtaaagacatttgaagagctgcggctaaaggaagagttactaaaaggaatctatgcaatgggatttaataggccatctaaaatccaagagatggctctccctatgatgctggcacatccaccccagaacctcatagcacagagccagtctggaacaggaaagacagcggcatttgtgttggcaatgttaagcagagttaatgccttggaattgttcccacagtgcctctgcctagctcctacttatgaattggctctgcaaactggccgtgtggttgagcagatgggaaaattctgtgtggatgttcaagtgatgtatgccattcgagggaatcgaattcccagaggcaccgacatcactaaacagattataattggcactcctgggactgtcctagattggtgttttaaactaaaattgattgatttgactaagattcgtgtgtttgtcctggatgaagcagatgtgatgattgacactcaaggattctcagatcatagtattcgtattcaaagagctctaccctccgaatgccaaatgctcctcttttcagcaacctttgaggactctgtgtggcactttgctgagcgaatcatccctgaccctaatgttatcaagttacgcaaagaggagctcacactgaacaacatccggcaatattacgtgctgtgtgagcacaggaaagacaaataccaagctctgtgcaacatttatggcagcatcaccattggtcaggccatcatcttctgccagactcgtcgaaacgctaagtggttgaccgtggagatgatacaggatggccaccaggtgtctttgttaagcggggagctgaccgtggagcagcgagcttccatcattcagaggtttcgggatgggaaagagaaggttctcataacaactaatgtttgcgcccgagggattgatgtgaagcaggtcacaattgttgtgaactttgatctccctgtaaaacaaggagaggagccggactatgagacctacctccaccgcatagggcggacggggcgctttgggaaaaaaggccttgccttcaacatgattgaagtagatgagctgccctcgctcatgaaaatccaggaccactttaacagcagtattaagcaactcaacgctgaagacatggatgaaattgaaaagattgactattga
Sequence Length
1452
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,034 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 25, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 25
NCBI Official Symbol
DDX25
NCBI Official Synonym Symbols
GRTH
NCBI Protein Information
ATP-dependent RNA helicase DDX25
UniProt Protein Name
ATP-dependent RNA helicase DDX25
UniProt Gene Name
DDX25
UniProt Synonym Gene Names
GRTH
UniProt Entry Name
DDX25_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The encoded protein is a gonadotropin-regulated and developmentally expressed testicular RNA helicase. It may serve to maintain testicular functions related to steroidogenesis and spermatogenesis. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX25: ATP-dependent RNA helicase. Required for mRNA export and translation regulation during spermatid development. Belongs to the DEAD box helicase family. 2 isoforms of the human protein are produced by alternative initiation.

Protein type: EC 3.6.4.13; Cell development/differentiation; Helicase

Chromosomal Location of Human Ortholog: 11q24

Cellular Component: cytoplasm; nucleus

Molecular Function: ATP binding; ATP-dependent RNA helicase activity

Biological Process: mRNA export from nucleus; regulation of translation; RNA secondary structure unwinding; spermatid development

Research Articles on DDX25

Similar Products

Product Notes

The DDX25 ddx25 (Catalog #AAA1274002) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgtcgt tactgtgggg aggcgacgca ggggcggcgg agagcgagcg gctgaacagc cacttttcaa acctcagcca accccggaag aacctttggg gtattaagag tactgcagtc cgaaacatag atggttctat taataacatc aatgaagatg atgaagaaga tgtagtggat ttggcagcta attcactctt aaacaagtta atccatcaat ccttagtaga atccagtcac cgtgtggaag ttttacagaa ggatcccagc tctccacttt actcagtaaa gacatttgaa gagctgcggc taaaggaaga gttactaaaa ggaatctatg caatgggatt taataggcca tctaaaatcc aagagatggc tctccctatg atgctggcac atccacccca gaacctcata gcacagagcc agtctggaac aggaaagaca gcggcatttg tgttggcaat gttaagcaga gttaatgcct tggaattgtt cccacagtgc ctctgcctag ctcctactta tgaattggct ctgcaaactg gccgtgtggt tgagcagatg ggaaaattct gtgtggatgt tcaagtgatg tatgccattc gagggaatcg aattcccaga ggcaccgaca tcactaaaca gattataatt ggcactcctg ggactgtcct agattggtgt tttaaactaa aattgattga tttgactaag attcgtgtgt ttgtcctgga tgaagcagat gtgatgattg acactcaagg attctcagat catagtattc gtattcaaag agctctaccc tccgaatgcc aaatgctcct cttttcagca acctttgagg actctgtgtg gcactttgct gagcgaatca tccctgaccc taatgttatc aagttacgca aagaggagct cacactgaac aacatccggc aatattacgt gctgtgtgag cacaggaaag acaaatacca agctctgtgc aacatttatg gcagcatcac cattggtcag gccatcatct tctgccagac tcgtcgaaac gctaagtggt tgaccgtgga gatgatacag gatggccacc aggtgtcttt gttaagcggg gagctgaccg tggagcagcg agcttccatc attcagaggt ttcgggatgg gaaagagaag gttctcataa caactaatgt ttgcgcccga gggattgatg tgaagcaggt cacaattgtt gtgaactttg atctccctgt aaaacaagga gaggagccgg actatgagac ctacctccac cgcatagggc ggacggggcg ctttgggaaa aaaggccttg ccttcaacat gattgaagta gatgagctgc cctcgctcat gaaaatccag gaccacttta acagcagtat taagcaactc aacgctgaag acatggatga aattgaaaag attgactatt ga. It is sometimes possible for the material contained within the vial of "DDX25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.