Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX23 cdna clone

DDX23 cDNA Clone

Gene Names
DDX23; prp28; PRPF28; U5-100K; SNRNP100; U5-100KD
Synonyms
DDX23; DDX23 cDNA Clone; DDX23 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaggagagctggctgacaaaaaggaccgtgatgcatcaccttccaaggaggaaaggaagcgatcacggactcctgacagagagcgggatagagaccgggaccggaagtcttccccatctaaagatagaaagcggcatcgttcaagggatagacgtcgaggaggcagccgttctcgctctcgttcccgttccaaatctgcagaaagagaacgacggcacaaagaacgagaacgagataaggagcgggatcggaataagaaggaccgagatcgagacaaggatgggcacagacgggacaaggaccgtaaacgatccagcttatctcctggtcgaggaaaagactttaaatctcggaaggacagagactctaagaaggatgaagaggatgaacatggtgataagaagcctaaggcccagccattatccctggaggagcttctggccaagaaaaaggctgaggaagaagctgaggctaagcccaagttcctctctaaagcagaacgagaggctgaagctctaaagcgacggcagcaggaggtggaagagcggcagaggatgcttgaagaagagaggaagaaaaggaaacagttccaagacttgggcaggaagatgttggaagatcctcaggaacgggaacgtcgggaacgcagggagaggatggaacgggagaccaatggaaatgaggatgaggaagggcggcagaagatccgggaagagaaggataagagcaaggaactgcatgccattaaggagcgttacctgggtggcatcaaaaagcggcgccgaacgagacatctcaatgaccggaaatttgtttttgagtgggatgcatctgaggacacatccattgactacaaccccctgtacaaagaacggcaccaggtgcagttgttagggcgaggcttcattgcaggcattgacctcaagcagcagaagcgagagcagtcacgtttctatggagacctaatggagaagaggcgaaccctggaagaaaaggagcaggaggaggcaagactccgcaaacttcgtaagaaggaagccaagcagcgctgggatgatcgtcattggtctcagaaaaagttagatgagatgacggacagggactggcggatcttccgtgaggactacagcatcaccaccaaaggtggcaagatccccaatcccatccgatcctggaaagactcttctctgcccccacacatcttggaggtcattgataagtgtggctacaaggaaccaacacctatacagcgtcaggcaattcccattgggctacagaatcgtgacatcattggtgtggctgagactggcagtggcaagacagcagccttcctcatccctctgctggtctggatcaccacacttcccaaaattgacaggatcgaagagtcagaccaaggcccttatgccatcatcctggctcccacccgtgagttggctcaacagattgaggaagagaccatcaagtttgggaaaccgctaggtatccgcactgtggctgtcattggtggcatctccagagaagaccagggcttcaggctgcgcatgggttgtgagattgtgattgctacccctgggcgtttgattgatgtgctggagaaccgctacctggtgctgagccgctgtacctatgtggttctggatgaggcagataggatgattgacatgggctttgagccagatgtccagaagatcctggagcacatgcctgtcagcaaccagaagccagacacggatgaggctgaggaccctgagaagatgctggccaactttgagtcgggaaaacataagtaccgccaaacagtcatgttcacggccaccatgcccccagcggtggagcgtctggccaggagctatcttcggcgacctgctgtggtgtacattggctccgcaggcaagccccatgagcgtgtggaacagaaggtcttcctcatgtcagagtcagaaaagaggaaaaagctgctggcaatcttggagcaaggctttgacccacccatcattatttttgtcaaccagaagaagggctgcgacgtgttggccaaatccctggagaagatggggtacaatgcttgcacactgcacggtggaaaaggccaggagcagcgagagtttgcgttgtccaacctcaaggctggggccaaggatattttggtggctacagatgtggctggtcgtggtattgacatccaagatgtgtctatggttgtcaactatgatatggccaaaaatattgaagattacatccaccgcattggccgcacgggacgagcaggcaagagtggggtggccatcaccttcctcacaaaagaggactctgctgtgttctacgagctgaagcaagctatcctggaaagcccagtgtcttcctgtccccccgaactagccaaccacccagatgcccagcataagccaggcaccatcctcaccaagaagcgccgggaagagaccatctttgcctga
Sequence Length
2463
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,401 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 23, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 23
NCBI Official Symbol
DDX23
NCBI Official Synonym Symbols
prp28; PRPF28; U5-100K; SNRNP100; U5-100KD
NCBI Protein Information
probable ATP-dependent RNA helicase DDX23
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX23
UniProt Gene Name
DDX23
UniProt Entry Name
DDX23_HUMAN

NCBI Description

This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the U5 snRNP complex; it may facilitate conformational changes in the spliceosome during nuclear pre-mRNA splicing. An alternatively spliced transcript variant has been found for this gene, but its biological validity has not been determined. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX23: Involved in pre-mRNA splicing and its phosphorylated form (by SRPK2) is required for spliceosomal B complex formation. Belongs to the DEAD box helicase family. DDX23/PRP28 subfamily.

Protein type: RNA splicing; EC 3.6.4.13; RNA processing; Helicase; Spliceosome; RNA-binding

Chromosomal Location of Human Ortholog: 12q13.12

Cellular Component: nucleolus; nucleoplasm; nucleus; snRNP U5

Molecular Function: ATP-dependent helicase activity; ATP-dependent RNA helicase activity; protein binding

Biological Process: cis assembly of pre-catalytic spliceosome; nuclear mRNA splicing, via spliceosome; RNA secondary structure unwinding; RNA splicing; RNA splicing, via transesterification reactions

Research Articles on DDX23

Similar Products

Product Notes

The DDX23 ddx23 (Catalog #AAA1269981) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggag agctggctga caaaaaggac cgtgatgcat caccttccaa ggaggaaagg aagcgatcac ggactcctga cagagagcgg gatagagacc gggaccggaa gtcttcccca tctaaagata gaaagcggca tcgttcaagg gatagacgtc gaggaggcag ccgttctcgc tctcgttccc gttccaaatc tgcagaaaga gaacgacggc acaaagaacg agaacgagat aaggagcggg atcggaataa gaaggaccga gatcgagaca aggatgggca cagacgggac aaggaccgta aacgatccag cttatctcct ggtcgaggaa aagactttaa atctcggaag gacagagact ctaagaagga tgaagaggat gaacatggtg ataagaagcc taaggcccag ccattatccc tggaggagct tctggccaag aaaaaggctg aggaagaagc tgaggctaag cccaagttcc tctctaaagc agaacgagag gctgaagctc taaagcgacg gcagcaggag gtggaagagc ggcagaggat gcttgaagaa gagaggaaga aaaggaaaca gttccaagac ttgggcagga agatgttgga agatcctcag gaacgggaac gtcgggaacg cagggagagg atggaacggg agaccaatgg aaatgaggat gaggaagggc ggcagaagat ccgggaagag aaggataaga gcaaggaact gcatgccatt aaggagcgtt acctgggtgg catcaaaaag cggcgccgaa cgagacatct caatgaccgg aaatttgttt ttgagtggga tgcatctgag gacacatcca ttgactacaa ccccctgtac aaagaacggc accaggtgca gttgttaggg cgaggcttca ttgcaggcat tgacctcaag cagcagaagc gagagcagtc acgtttctat ggagacctaa tggagaagag gcgaaccctg gaagaaaagg agcaggagga ggcaagactc cgcaaacttc gtaagaagga agccaagcag cgctgggatg atcgtcattg gtctcagaaa aagttagatg agatgacgga cagggactgg cggatcttcc gtgaggacta cagcatcacc accaaaggtg gcaagatccc caatcccatc cgatcctgga aagactcttc tctgccccca cacatcttgg aggtcattga taagtgtggc tacaaggaac caacacctat acagcgtcag gcaattccca ttgggctaca gaatcgtgac atcattggtg tggctgagac tggcagtggc aagacagcag ccttcctcat ccctctgctg gtctggatca ccacacttcc caaaattgac aggatcgaag agtcagacca aggcccttat gccatcatcc tggctcccac ccgtgagttg gctcaacaga ttgaggaaga gaccatcaag tttgggaaac cgctaggtat ccgcactgtg gctgtcattg gtggcatctc cagagaagac cagggcttca ggctgcgcat gggttgtgag attgtgattg ctacccctgg gcgtttgatt gatgtgctgg agaaccgcta cctggtgctg agccgctgta cctatgtggt tctggatgag gcagatagga tgattgacat gggctttgag ccagatgtcc agaagatcct ggagcacatg cctgtcagca accagaagcc agacacggat gaggctgagg accctgagaa gatgctggcc aactttgagt cgggaaaaca taagtaccgc caaacagtca tgttcacggc caccatgccc ccagcggtgg agcgtctggc caggagctat cttcggcgac ctgctgtggt gtacattggc tccgcaggca agccccatga gcgtgtggaa cagaaggtct tcctcatgtc agagtcagaa aagaggaaaa agctgctggc aatcttggag caaggctttg acccacccat cattattttt gtcaaccaga agaagggctg cgacgtgttg gccaaatccc tggagaagat ggggtacaat gcttgcacac tgcacggtgg aaaaggccag gagcagcgag agtttgcgtt gtccaacctc aaggctgggg ccaaggatat tttggtggct acagatgtgg ctggtcgtgg tattgacatc caagatgtgt ctatggttgt caactatgat atggccaaaa atattgaaga ttacatccac cgcattggcc gcacgggacg agcaggcaag agtggggtgg ccatcacctt cctcacaaaa gaggactctg ctgtgttcta cgagctgaag caagctatcc tggaaagccc agtgtcttcc tgtccccccg aactagccaa ccacccagat gcccagcata agccaggcac catcctcacc aagaagcgcc gggaagagac catctttgcc tga. It is sometimes possible for the material contained within the vial of "DDX23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.