Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDRGK1 cdna clone

DDRGK1 cDNA Clone

Gene Names
DDRGK1; UFBP1; C20orf116; dJ1187M17.3
Synonyms
DDRGK1; DDRGK1 cDNA Clone; DDRGK1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggcgcctgtgtggtacttggtagcggcggctctgctagtcggctttatcctcttcctgactcgcagccggggccgggcggcatcagccggccaagagccactgcacaatgaggagctggcaggagcaggccgggtggcccagcctgggcccctggagcctgaggagccgagagctggaggcaggcctcggcgccggagggacctgggcagccgcctacaggcccagcgtcgagcccagcgggtggcctgggcagaagcagatgagaacgaggaggaagctgtcatcctagcccaggaggaggaaggtgtcgagaagccagcggaaactcacctgtcggggaaaattggagctaagaaactgcggaagctggaggagaaacaagcgcgaaaggcccagcgtgaggcagaggaggctgaacgtgaggagcggaaacgactcgagtcccagcgcgaagctgagtggaagaaggaggaggagcggcttcgcctggaggaggagcagaaggaggaggaggagaggaaggcccgcgaggagcaggcccagcgggagcatgaggagtacctgaaactgaaggaggcctttgtggtggaggaggaaggcgtaggagagaccatgactgaggaacagtcccagagcttcctgacagagttcatcaactacatcaagcagtccaaggttgtgctcttggaagacctggcttcccaggtgggcctacgcactcaggacaccataaatcgcatccaggacctgctggctgaggggactataacaggtgtgattgacgaccggggcaagttcatctacataaccccagaggaactggccgccgtggccaacttcatccgacagcggggccgggtgtccatcgccgagcttgcccaagccagcaactccctcatcgcctggggccgggagtcccctgcccaagccccagcctga
Sequence Length
945
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,475 Da
NCBI Official Full Name
Homo sapiens DDRGK domain containing 1, mRNA
NCBI Official Synonym Full Names
DDRGK domain containing 1
NCBI Official Symbol
DDRGK1
NCBI Official Synonym Symbols
UFBP1; C20orf116; dJ1187M17.3
NCBI Protein Information
DDRGK domain-containing protein 1
UniProt Protein Name
DDRGK domain-containing protein 1
UniProt Gene Name
DDRGK1
UniProt Entry Name
DDRGK_HUMAN

NCBI Description

The protein encoded by this gene interacts with components of the ubiquitin fold modifier 1 conjugation pathway and helps prevent apoptosis in ER-stressed secretory tissues. In addition, the encoded protein regulates nuclear factor-κB activity. [provided by RefSeq, Dec 2015]

Uniprot Description

DDRGK1: Belongs to the DDRGK1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 20p13

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane

Molecular Function: protein binding

Biological Process: activation of NF-kappaB transcription factor; regulation of estrogen receptor signaling pathway

Research Articles on DDRGK1

Similar Products

Product Notes

The DDRGK1 ddrgk1 (Catalog #AAA1273512) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggcgc ctgtgtggta cttggtagcg gcggctctgc tagtcggctt tatcctcttc ctgactcgca gccggggccg ggcggcatca gccggccaag agccactgca caatgaggag ctggcaggag caggccgggt ggcccagcct gggcccctgg agcctgagga gccgagagct ggaggcaggc ctcggcgccg gagggacctg ggcagccgcc tacaggccca gcgtcgagcc cagcgggtgg cctgggcaga agcagatgag aacgaggagg aagctgtcat cctagcccag gaggaggaag gtgtcgagaa gccagcggaa actcacctgt cggggaaaat tggagctaag aaactgcgga agctggagga gaaacaagcg cgaaaggccc agcgtgaggc agaggaggct gaacgtgagg agcggaaacg actcgagtcc cagcgcgaag ctgagtggaa gaaggaggag gagcggcttc gcctggagga ggagcagaag gaggaggagg agaggaaggc ccgcgaggag caggcccagc gggagcatga ggagtacctg aaactgaagg aggcctttgt ggtggaggag gaaggcgtag gagagaccat gactgaggaa cagtcccaga gcttcctgac agagttcatc aactacatca agcagtccaa ggttgtgctc ttggaagacc tggcttccca ggtgggccta cgcactcagg acaccataaa tcgcatccag gacctgctgg ctgaggggac tataacaggt gtgattgacg accggggcaa gttcatctac ataaccccag aggaactggc cgccgtggcc aacttcatcc gacagcgggg ccgggtgtcc atcgccgagc ttgcccaagc cagcaactcc ctcatcgcct ggggccggga gtcccctgcc caagccccag cctga. It is sometimes possible for the material contained within the vial of "DDRGK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.