Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDIT3 cdna clone

DDIT3 cDNA Clone

Gene Names
DDIT3; CHOP; CEBPZ; CHOP10; CHOP-10; GADD153
Synonyms
DDIT3; DDIT3 cDNA Clone; DDIT3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagctgagtcattgcctttctcctttgggacactgtccagctgggagctggaagcctggtatgaggacctgcaagaggtcctgtcttcagatgaaaatgggggtacctatgtttcacctcctggaaatgaagaggaagaatcaaaaatcttcaccactcttgaccctgcttctctggcttggctgactgaggaggagccagaaccagcagaggtcacaagcacctcccagagccctcactctccagattccagtcagagctccctggctcaggaggaagaggaggaagaccaagggagaaccaggaaacggaaacagagtggtcattccccagcccgggctggaaagcagcgcatgaaggagaaagaacaggagaatgaaaggaaagtggcacagctagctgaagagaatgaacggctcaagcaggaaatcgagcgcctgaccagggaagtagaggcgactcgccgagctctgattgaccgaatggtgaatctgcaccaagcatga
Sequence Length
510
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,700 Da
NCBI Official Full Name
Homo sapiens DNA-damage-inducible transcript 3, mRNA
NCBI Official Synonym Full Names
DNA damage inducible transcript 3
NCBI Official Symbol
DDIT3
NCBI Official Synonym Symbols
CHOP; CEBPZ; CHOP10; CHOP-10; GADD153
NCBI Protein Information
DNA damage-inducible transcript 3 protein
UniProt Protein Name
DNA damage-inducible transcript 3 protein
UniProt Gene Name
DDIT3
UniProt Synonym Gene Names
CHOP; CHOP10; GADD153; DDIT-3; CHOP; CHOP-10
UniProt Entry Name
DDIT3_HUMAN

NCBI Description

This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010]

Uniprot Description

CHOP: a transcriptional-regulatory protein of the bZIP family. Inhibits the DNA-binding activity of C/EBP and LAP by forming heterodimers that cannot bind DNA. May play an important role in melanoma progression. CK2-mediated phosphorylation inhibits its transcriptional activity. Up-regulates IL-6 transcription by trapping negative regulating NF-IL6 isoform.

Protein type: Oncoprotein; Autophagy; Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 12q13.1-q13.2

Cellular Component: cytosol; nucleoplasm; nucleus

Molecular Function: cAMP response element binding protein binding; DNA binding; leucine zipper domain binding; protein binding; protein heterodimerization activity; protein homodimerization activity; transcription corepressor activity; transcription factor activity; transcription factor binding

Biological Process: cell cycle arrest; cell redox homeostasis; inhibition of CREB transcription factor; mRNA transcription from RNA polymerase II promoter; negative regulation of protein kinase B signaling cascade; negative regulation of transcription factor activity; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; positive regulation of interleukin-8 production; positive regulation of neuron apoptosis; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; proteasomal ubiquitin-dependent protein catabolic process; regulation of transcription in response to stress; regulation of transcription, DNA-dependent; response to DNA damage stimulus; response to unfolded protein

Disease: Myxoid Liposarcoma

Research Articles on DDIT3

Similar Products

Product Notes

The DDIT3 ddit3 (Catalog #AAA1268133) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagctg agtcattgcc tttctccttt gggacactgt ccagctggga gctggaagcc tggtatgagg acctgcaaga ggtcctgtct tcagatgaaa atgggggtac ctatgtttca cctcctggaa atgaagagga agaatcaaaa atcttcacca ctcttgaccc tgcttctctg gcttggctga ctgaggagga gccagaacca gcagaggtca caagcacctc ccagagccct cactctccag attccagtca gagctccctg gctcaggagg aagaggagga agaccaaggg agaaccagga aacggaaaca gagtggtcat tccccagccc gggctggaaa gcagcgcatg aaggagaaag aacaggagaa tgaaaggaaa gtggcacagc tagctgaaga gaatgaacgg ctcaagcagg aaatcgagcg cctgaccagg gaagtagagg cgactcgccg agctctgatt gaccgaatgg tgaatctgca ccaagcatga. It is sometimes possible for the material contained within the vial of "DDIT3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.