Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DCPS cdna clone

DCPS cDNA Clone

Gene Names
DCPS; ARS; DCS1; HSL1; HINT5; HINT-5; HSPC015
Synonyms
DCPS; DCPS cDNA Clone; DCPS cdna clone
Ordering
For Research Use Only!
Sequence
atggcggacgcagctcctcaactaggcaagaggaagcgcgaattggacgtggaggaggcccacgccgccagcacagaggaaaaggaggcaggagttggaaatggtacctgtgctcctgtccgcttaccgttctccggcttcagactgcagaaggtgctgagggagtctgcgcgggacaaaatcattttcctacacgggaaggtgaatgaggcctctgaggatggggatggagaggatgccgttgtgatcctggagaagacgccatttcaggtggaacaggtggctcagctcctgacgggcagccctgagctccaattgcagttctccaatgatatctacagcacctatcacttgttccctccaagacaactgaatgatgtaaagacgaccgtggtttaccctgccacagagaaacacctgcagaagtacctgcgccaggacctccgcctgatccgagagacgggagatgactacaggaacattactttaccccacctggagtcccagagcctcagcatccagtgggtgtataacattctcgacaagaaggctgaagcggaccggattgttttcgagaacccagatccctctgatggttttgtcctcatccctgacctcaagtggaaccaacagcagctcgatgacttgtacttgatcgccatctgccatcgccggggcatcagatccctacgcgaccttactccggagcacttgccgctgctcaggaacatcctccaccaggggcaggaggccatcctgcagcgctaccggatgaagggagaccatctgcgagtatacctgcactacctgccctcctactaccacctgcatgtgcacttcaccgccctgggcttcgaggcccccggctcaggcgtggagcgggcccacctgctggctgaggtgatcgagaacttggagtgtgaccctaggcactaccagcagcgcacgctcaccttcgccctcagggctgacgaccccctgctcaagctcttgcaggaggctcagcaaagctga
Sequence Length
1014
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,609 Da
NCBI Official Full Name
Homo sapiens decapping enzyme, scavenger, mRNA
NCBI Official Synonym Full Names
decapping enzyme, scavenger
NCBI Official Symbol
DCPS
NCBI Official Synonym Symbols
ARS; DCS1; HSL1; HINT5; HINT-5; HSPC015
NCBI Protein Information
m7GpppX diphosphatase
UniProt Protein Name
m7GpppX diphosphatase
Protein Family
UniProt Gene Name
DCPS
UniProt Synonym Gene Names
DCS1; HINT5; HINT-5
UniProt Entry Name
DCPS_HUMAN

Uniprot Description

DCPS: Necessary for the complete degradation of mRNAs, both in normal mRNA turnover and in nonsense-mediated mRNA decay. Removes the 7-methyl guanine cap structure from mRNA fragments shorter than 10 nucleotides that are produced by 3'->5' exosome-mediated mRNA decay. Releases m7GMP. Can also degrade m7GDP to m7GMP. Has no activity towards mRNA molecules longer than 25 nucleotides. Belongs to the HIT family.

Protein type: EC 3.6.1.59; Hydrolase; RNA splicing

Chromosomal Location of Human Ortholog: 11q24.2

Cellular Component: cytoplasm; cytosol; mitochondrion; nucleoplasm; nucleus

Molecular Function: exoribonuclease activity; m7G(5')pppN diphosphatase activity; protein binding; RNA 7-methylguanosine cap binding

Biological Process: mRNA catabolic process, deadenylation-dependent decay; negative regulation of programmed cell death; nuclear mRNA cis splicing, via U2-type spliceosome

Disease: Al-raqad Syndrome

Research Articles on DCPS

Similar Products

Product Notes

The DCPS dcps (Catalog #AAA1273240) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggacg cagctcctca actaggcaag aggaagcgcg aattggacgt ggaggaggcc cacgccgcca gcacagagga aaaggaggca ggagttggaa atggtacctg tgctcctgtc cgcttaccgt tctccggctt cagactgcag aaggtgctga gggagtctgc gcgggacaaa atcattttcc tacacgggaa ggtgaatgag gcctctgagg atggggatgg agaggatgcc gttgtgatcc tggagaagac gccatttcag gtggaacagg tggctcagct cctgacgggc agccctgagc tccaattgca gttctccaat gatatctaca gcacctatca cttgttccct ccaagacaac tgaatgatgt aaagacgacc gtggtttacc ctgccacaga gaaacacctg cagaagtacc tgcgccagga cctccgcctg atccgagaga cgggagatga ctacaggaac attactttac cccacctgga gtcccagagc ctcagcatcc agtgggtgta taacattctc gacaagaagg ctgaagcgga ccggattgtt ttcgagaacc cagatccctc tgatggtttt gtcctcatcc ctgacctcaa gtggaaccaa cagcagctcg atgacttgta cttgatcgcc atctgccatc gccggggcat cagatcccta cgcgacctta ctccggagca cttgccgctg ctcaggaaca tcctccacca ggggcaggag gccatcctgc agcgctaccg gatgaaggga gaccatctgc gagtatacct gcactacctg ccctcctact accacctgca tgtgcacttc accgccctgg gcttcgaggc ccccggctca ggcgtggagc gggcccacct gctggctgag gtgatcgaga acttggagtg tgaccctagg cactaccagc agcgcacgct caccttcgcc ctcagggctg acgaccccct gctcaagctc ttgcaggagg ctcagcaaag ctga. It is sometimes possible for the material contained within the vial of "DCPS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.