Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DCBLD2 cdna clone

DCBLD2 cDNA Clone

Gene Names
DCBLD2; ESDN; CLCP1
Synonyms
DCBLD2; DCBLD2 cDNA Clone; DCBLD2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctctgttcctcctgctcttacttgtcctgctgctgctgctcgaggacgctggagcccagcaaggtgatggatgtggacacactgtactaggccctgagagtggaacccttacatccataaactacccacagacctatcccaacagcactgtttgtgaatgggagatccgtgtaaagatgggagagagagttcgcatcaaatttggtgactttgacattgaagattctgattcttgtcactttaattacttgagaatttataatggaattggagtcagcagaactgaaataggcaaatactgtggtctggggttgcaaatgaaccattcaattgaatcaaaaggcaatgaaatcacattgctgttcatgagtggaatccatgtttctggacgcggatttttggcctcatactctgttatagataaacaagatctaattacttgtttggacactgcatccaattttttggaacctgagttcagtaagtactgcccagctggttgtctgcttccttttgctgagatatctggaacaattcctcatggatatagagattcctcgccattgtgcatggctggtgtgcatgcaggagtagtgtcaaacacgttgggcggccaaatcagtgttgtaattagtaaaggtatcccctattatgaaagttctttggctaacaacgtcacatctgtggtgggacacttatctacaagtctttttacatttaagacaagtggatgttatggaacactggggatggagtctggtgtgatcgcggatcctcaaataacagcatcatctgtgctggagtggactgaccacacagggcaagagaacagttggaaacccaaaaaagccaggctgaaaaaacctggaccgccttgggctgcttttgccactgatgaataccagtggttacaaatagatttgaataaggaaaagaaaataacaggcattataaccactggatccaccatggtggagcacaattactatgtgtctgcctacagaatcctgtacagtgatgatgggcagaaatggactgtgtacagagagcctggtgtggagcaagataagatatttcaaggaaacaaagattatcaccaggatgtgcgtaataactttttgccaccaattattgcacgttttattagagtgaatcctacccaatggcagcagaaaattgccatgaaaatggagctgctcggatgtcagtttattcctaaaggtcgtcctccaaaacttactcaacctccacctcctcggaacagcaatgacctcaaaaacactacagcccctccaaaaatagccaaaggtcgtgccccaaaatttacgcaaccactacaacctcgcagtagcaatgaatttcctgcacagacagaacaaacaactgccagtcctgatatcagaaatactaccgtaactccaaatgtaaccaaagatgtagcgctggctgcagttcttgtccctgtgctggtcatggtcctcactactctcattctcatattagtgtgtgcttggcactggagaaacagaaagaaaaaaactgaaggcacctatgacttaccttactgggaccgggcaggtttttatttaatggtctctttggcttgccgtcacaatgaaggttggtggaaaggaatgaagcagtttcttcctgcaaaagcagtggaccatgaggaaaccccagttcgctatagcagcagtgaagttaatcacctgagtccaagagaagtcaccacagtgctgcaggctgactctgcagagtatgctcagccactggtaggaggaattgttggtacacttcatcaaagatctacctttaaaccagaagaaggaaaagaagcaggctatgcagacctagatccttacaactcaccagggcaggaagtttatcatgcctatgctgaaccactcccaattacggggcctgagtatgcaaccccaatcatcatggacatgtcagggcaccccacaacttcagttggtcagccctccacatccactttcaaggctacggggaaccaacctcccccactagtgggaacttacaatacacttctctccaggactgacagctgctcctcagcccaggcccagtatgataccccgaaagctgggaagccaggtctacctgccccagacgaattggtgtaccaggtgccacagagcacacaagaagtatcaggagcaggaagggatggggaatgtgatgtttttaaagaaatcctttga
Sequence Length
2232
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
86,657 Da
NCBI Official Full Name
Homo sapiens discoidin, CUB and LCCL domain containing 2, mRNA
NCBI Official Synonym Full Names
discoidin, CUB and LCCL domain containing 2
NCBI Official Symbol
DCBLD2
NCBI Official Synonym Symbols
ESDN; CLCP1
NCBI Protein Information
discoidin, CUB and LCCL domain-containing protein 2
UniProt Protein Name
Discoidin, CUB and LCCL domain-containing protein 2
UniProt Gene Name
DCBLD2
UniProt Synonym Gene Names
CLCP1; ESDN
UniProt Entry Name
DCBD2_HUMAN

Uniprot Description

DCBLD2: a type-I transmembrane protein. May be involved in vascular remodeling and influence vascular smooth muscle cell proliferation. Contains a CUB domain and a coagulation factor V/VIII homology domain, similar to the structure of the neuropilins. Plays a role in cell motility. SEMA4B appears to be one of its ligands. Strongly expressed in nerve bundles. Highly expressed in testis, heart, skeletal muscle and also in cultured vascular smooth muscle cells. Increased in lung cancers during the process of tumor progression. A target of EGF signaling in the A431 cervical cancer cell-line. Two isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Cell adhesion

Chromosomal Location of Human Ortholog: 3q12.1|3

Cellular Component: cell surface; integral to plasma membrane

Molecular Function: protein binding

Biological Process: negative regulation of cell growth; wound healing

Research Articles on DCBLD2

Similar Products

Product Notes

The DCBLD2 dcbld2 (Catalog #AAA1265986) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctctgt tcctcctgct cttacttgtc ctgctgctgc tgctcgagga cgctggagcc cagcaaggtg atggatgtgg acacactgta ctaggccctg agagtggaac ccttacatcc ataaactacc cacagaccta tcccaacagc actgtttgtg aatgggagat ccgtgtaaag atgggagaga gagttcgcat caaatttggt gactttgaca ttgaagattc tgattcttgt cactttaatt acttgagaat ttataatgga attggagtca gcagaactga aataggcaaa tactgtggtc tggggttgca aatgaaccat tcaattgaat caaaaggcaa tgaaatcaca ttgctgttca tgagtggaat ccatgtttct ggacgcggat ttttggcctc atactctgtt atagataaac aagatctaat tacttgtttg gacactgcat ccaatttttt ggaacctgag ttcagtaagt actgcccagc tggttgtctg cttccttttg ctgagatatc tggaacaatt cctcatggat atagagattc ctcgccattg tgcatggctg gtgtgcatgc aggagtagtg tcaaacacgt tgggcggcca aatcagtgtt gtaattagta aaggtatccc ctattatgaa agttctttgg ctaacaacgt cacatctgtg gtgggacact tatctacaag tctttttaca tttaagacaa gtggatgtta tggaacactg gggatggagt ctggtgtgat cgcggatcct caaataacag catcatctgt gctggagtgg actgaccaca cagggcaaga gaacagttgg aaacccaaaa aagccaggct gaaaaaacct ggaccgcctt gggctgcttt tgccactgat gaataccagt ggttacaaat agatttgaat aaggaaaaga aaataacagg cattataacc actggatcca ccatggtgga gcacaattac tatgtgtctg cctacagaat cctgtacagt gatgatgggc agaaatggac tgtgtacaga gagcctggtg tggagcaaga taagatattt caaggaaaca aagattatca ccaggatgtg cgtaataact ttttgccacc aattattgca cgttttatta gagtgaatcc tacccaatgg cagcagaaaa ttgccatgaa aatggagctg ctcggatgtc agtttattcc taaaggtcgt cctccaaaac ttactcaacc tccacctcct cggaacagca atgacctcaa aaacactaca gcccctccaa aaatagccaa aggtcgtgcc ccaaaattta cgcaaccact acaacctcgc agtagcaatg aatttcctgc acagacagaa caaacaactg ccagtcctga tatcagaaat actaccgtaa ctccaaatgt aaccaaagat gtagcgctgg ctgcagttct tgtccctgtg ctggtcatgg tcctcactac tctcattctc atattagtgt gtgcttggca ctggagaaac agaaagaaaa aaactgaagg cacctatgac ttaccttact gggaccgggc aggtttttat ttaatggtct ctttggcttg ccgtcacaat gaaggttggt ggaaaggaat gaagcagttt cttcctgcaa aagcagtgga ccatgaggaa accccagttc gctatagcag cagtgaagtt aatcacctga gtccaagaga agtcaccaca gtgctgcagg ctgactctgc agagtatgct cagccactgg taggaggaat tgttggtaca cttcatcaaa gatctacctt taaaccagaa gaaggaaaag aagcaggcta tgcagaccta gatccttaca actcaccagg gcaggaagtt tatcatgcct atgctgaacc actcccaatt acggggcctg agtatgcaac cccaatcatc atggacatgt cagggcaccc cacaacttca gttggtcagc cctccacatc cactttcaag gctacgggga accaacctcc cccactagtg ggaacttaca atacacttct ctccaggact gacagctgct cctcagccca ggcccagtat gataccccga aagctgggaa gccaggtcta cctgccccag acgaattggt gtaccaggtg ccacagagca cacaagaagt atcaggagca ggaagggatg gggaatgtga tgtttttaaa gaaatccttt ga. It is sometimes possible for the material contained within the vial of "DCBLD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.