DCBLD1 cdna clone
DCBLD1 cDNA Clone
Gene Names
DCBLD1; dJ94G16.1
Synonyms
DCBLD1; DCBLD1 cDNA Clone; DCBLD1 cdna clone
Sequence
atggtgcccggcgcccgcggcggcggcgcactggcgcgggctgccgggcggggcctcctggctttgctgctcgcggtctccgccccgctccggctgcaggcggaggagctgggtgatggctgtggacacctagtgacttatcaggatagtggcacaatgacatctaagaattatcccgggacctaccccaatcacactgtttgcgaaaagacaattacagtaccaaaggggaaaagactgattctgaggttgggagatttggatatcgaatcccagacctgtgcttctgactatcttctcttcaccagctcttcagatcaatatggtccatactgtggaagtatgactgttcccaaagaactcttgttgaacacaagtgaagtaaccgtccgctttgagagtggatcccacatttctggccggggttttttgctgacctatgcgagcagcgaccatccagatttaataacatgtttggaacgagctagccattatttgaagacagaatacagcaaattctgcccagctggttgtagagacgtagcaggagacatttctgggaatatggtagatggatatagagatacctctttattgtgcaaagctgccatccatgcaggaataattgctgatgaactaggtggccagatcagtgtgcttcagcgcaaagggatcagtcgatatgaagggattctggccaatggtgttctttcgagggatggttccctgtcagacaagcgatttctgtttacctccaatggttgcagcagatccttgagttttgaacctgacgggcaaatcagagcttcttcctcatggcagtcggtcaatgagagtggagaccaagttcactggtctcctggccaagcccgacttcaggaccaaggcccatcatgggcttcgggcgacagtagcaacaaccacaaaccacgagagtggctggagatcgatttgggggagaaaaagaaaataacaggaattaggaccacaggatctacacagtcgaacttcaacttttatgttaagagttttgtgatgaacttcaaaaacaataattctaagtggaagacctataaaggaattgtgaataatgaagaaaaggtgtttcagggtaactctaactttcgggacccagtgcaaaacaatttcatccctcccatcgtggccagatatgtgcgggttgtcccccagacatggcaccagaggatagccttgaaggtggagctcattggttgccagattacacaaggtaatgattcattggtgtggcgcaagacaagtcaaagcaccagtgtttcaactaagaaagaagatgagacaatcacaaggcccatcccctcggaagaaacatccacaggaataaacattacaacggtggctattccattggtgctccttgttgtcctggtgtttgctggaatggggatctttgcagcctttagaaagaagaagaagaaaggaagtccgtatggatcagcagaggctcagaaaacagactgttggaagcagattaaatatccctttgccagacatcagtcagctgagtttaccatcagctatgataatgagaaggagatgacacaaaagttagatctcatcacaagtgatatggcaggttaa
Sequence Length
1620
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
59,196 Da
NCBI Official Full Name
Homo sapiens discoidin, CUB and LCCL domain containing 1, mRNA
NCBI Official Synonym Full Names
discoidin, CUB and LCCL domain containing 1
NCBI Official Symbol
DCBLD1
NCBI Official Synonym Symbols
dJ94G16.1
NCBI Protein Information
discoidin, CUB and LCCL domain-containing protein 1
UniProt Protein Name
Discoidin, CUB and LCCL domain-containing protein 1
Protein Family
UniProt Gene Name
DCBLD1
UniProt Entry Name
DCBD1_HUMAN
Uniprot Description
DCBLD1: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 6q22.1
Research Articles on DCBLD1
Similar Products
Product Notes
The DCBLD1 dcbld1 (Catalog #AAA1273902) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgcccg gcgcccgcgg cggcggcgca ctggcgcggg ctgccgggcg gggcctcctg gctttgctgc tcgcggtctc cgccccgctc cggctgcagg cggaggagct gggtgatggc tgtggacacc tagtgactta tcaggatagt ggcacaatga catctaagaa ttatcccggg acctacccca atcacactgt ttgcgaaaag acaattacag taccaaaggg gaaaagactg attctgaggt tgggagattt ggatatcgaa tcccagacct gtgcttctga ctatcttctc ttcaccagct cttcagatca atatggtcca tactgtggaa gtatgactgt tcccaaagaa ctcttgttga acacaagtga agtaaccgtc cgctttgaga gtggatccca catttctggc cggggttttt tgctgaccta tgcgagcagc gaccatccag atttaataac atgtttggaa cgagctagcc attatttgaa gacagaatac agcaaattct gcccagctgg ttgtagagac gtagcaggag acatttctgg gaatatggta gatggatata gagatacctc tttattgtgc aaagctgcca tccatgcagg aataattgct gatgaactag gtggccagat cagtgtgctt cagcgcaaag ggatcagtcg atatgaaggg attctggcca atggtgttct ttcgagggat ggttccctgt cagacaagcg atttctgttt acctccaatg gttgcagcag atccttgagt tttgaacctg acgggcaaat cagagcttct tcctcatggc agtcggtcaa tgagagtgga gaccaagttc actggtctcc tggccaagcc cgacttcagg accaaggccc atcatgggct tcgggcgaca gtagcaacaa ccacaaacca cgagagtggc tggagatcga tttgggggag aaaaagaaaa taacaggaat taggaccaca ggatctacac agtcgaactt caacttttat gttaagagtt ttgtgatgaa cttcaaaaac aataattcta agtggaagac ctataaagga attgtgaata atgaagaaaa ggtgtttcag ggtaactcta actttcggga cccagtgcaa aacaatttca tccctcccat cgtggccaga tatgtgcggg ttgtccccca gacatggcac cagaggatag ccttgaaggt ggagctcatt ggttgccaga ttacacaagg taatgattca ttggtgtggc gcaagacaag tcaaagcacc agtgtttcaa ctaagaaaga agatgagaca atcacaaggc ccatcccctc ggaagaaaca tccacaggaa taaacattac aacggtggct attccattgg tgctccttgt tgtcctggtg tttgctggaa tggggatctt tgcagccttt agaaagaaga agaagaaagg aagtccgtat ggatcagcag aggctcagaa aacagactgt tggaagcaga ttaaatatcc ctttgccaga catcagtcag ctgagtttac catcagctat gataatgaga aggagatgac acaaaagtta gatctcatca caagtgatat ggcaggttaa. It is sometimes possible for the material contained within the vial of "DCBLD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
