Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DACH1 cdna clone

DACH1 cDNA Clone

Gene Names
DACH1; DACH
Synonyms
DACH1; DACH1 cDNA Clone; DACH1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggatctgaggggggccaaagtggcttccttcacggtggagggctgcgagctgatctgcctgccccaggctttcgacctgttcctgaagcacttggtggggggcttgcatacggtctacaccaagctgaagcggctggagatcacgccggtggtgtgcaatgtggaacaagttcgcatcctgaggggactgggcgccatccagccaggagtgaaccgctgcaaactcatctccaggaaggacttcgagaccctctacaatgactgcaccaacgcaagttctagacctggaaggcctcctaagaggactcaaagtgtcacctccccagagaactctcacatcatgccgcattctgtccctggtctcatgtctcctgggataattccaccaacaggtctgacagcagccgctgcagcagctgctgctgctaccaatgcagctattgctgaagcaatgaaggtgaaaaaaatcaaattagaagccatgagcaactatcatgccagtaataaccaacatggagcagactctgaaaacggggacatgaattcaagtgtcggactggaacttccttttatgatgatgccccaccctctaattcctgtcagcctacctccagcatctgtcaccatggcaatgagccagatgaaccacctcagcaccattgcaaatatggcagcagcagcacaagttcagagtcccccatccagagttgagacatcagttattaaggagcgtgttcctgatagcccctcacctgccccctctctggaggaggggagaaggcctggcagtcacccatcatcacatcgcagcagcagcgtgtccagctcccctgctcggactgagagctcttctgacagaatcccggtccatcagaatgggttgtccatgaaccagatgctgatgggcttatcaccaaatgtacttcctgggcccaaagagggagatttggccggtcatgacatgggacatgagtcaaaaaggatgcatattgaaaaagatgagaccccgctttctacaccaaccgcaagagacagccttgacaaactctctctaactgggcatggacaaccactgcctccaggttttccatctccttttctgtttcctgatggactgtcttccatcgagactcttctgactaacatacaggggctgttgaaagttgccatagataatgccagagctcaagagaaacaggtccaactggaaaaaactgagctgaagatggattttttaagggaaagagaactaagggaaacacttgagaagcagttggctatggaacaaaagaatagagccatagttcaaaagaggctaaagaaggagaagaaggcaaagagaaaattgcaggaagcacttgagtttgagacgaaacggcgtgaacaagcagaacagacgctaaaacaggcagcttcaacagatagtctcagggtcttaaatgactctctgaccccagagatagaggctgaccgcagtggcggcagaacagatgctgaaaggacaatacaagatggaagactgtatttgaaaactactgtcatgtactga
Sequence Length
1554
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,005 Da
NCBI Official Full Name
Homo sapiens dachshund homolog 1 (Drosophila), mRNA
NCBI Official Synonym Full Names
dachshund family transcription factor 1
NCBI Official Symbol
DACH1
NCBI Official Synonym Symbols
DACH
NCBI Protein Information
dachshund homolog 1
UniProt Protein Name
Dachshund homolog 1
Protein Family
UniProt Gene Name
DACH1
UniProt Synonym Gene Names
DACH; Dach1
UniProt Entry Name
DACH1_HUMAN

NCBI Description

This gene encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Drosophila to human. Expression of this gene is lost in some forms of metastatic cancer, and is correlated with poor prognosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]

Uniprot Description

DACH1: Transcription factor that is involved in regulation of organogenesis. Seems to be a regulator of SIX1, SIX6 and probably SIX5. Corepression of precursor cell proliferation in myoblasts by SIX1 is switched to coactivation through recruitment of EYA3 to the SIX1-DACH1 complex. Transcriptional activation seems also to involve association of CREBBP. Seems to act as a corepressor of SIX6 in regulating proliferation by directly repressing cyclin- dependent kinase inhibitors, including the p27Kip1 promoter. Inhibits TGF-beta signaling through interaction with SMAD4 and NCOR1. Binds to chromatin DNA via its DACHbox-N domain. Belongs to the DACH/dachshund family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 13q22

Cellular Component: nucleus; transcription factor complex

Molecular Function: protein binding

Biological Process: multicellular organismal development; negative regulation of cell migration; negative regulation of transcription, DNA-dependent

Research Articles on DACH1

Similar Products

Product Notes

The DACH1 dach1 (Catalog #AAA1270574) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggatc tgaggggggc caaagtggct tccttcacgg tggagggctg cgagctgatc tgcctgcccc aggctttcga cctgttcctg aagcacttgg tggggggctt gcatacggtc tacaccaagc tgaagcggct ggagatcacg ccggtggtgt gcaatgtgga acaagttcgc atcctgaggg gactgggcgc catccagcca ggagtgaacc gctgcaaact catctccagg aaggacttcg agaccctcta caatgactgc accaacgcaa gttctagacc tggaaggcct cctaagagga ctcaaagtgt cacctcccca gagaactctc acatcatgcc gcattctgtc cctggtctca tgtctcctgg gataattcca ccaacaggtc tgacagcagc cgctgcagca gctgctgctg ctaccaatgc agctattgct gaagcaatga aggtgaaaaa aatcaaatta gaagccatga gcaactatca tgccagtaat aaccaacatg gagcagactc tgaaaacggg gacatgaatt caagtgtcgg actggaactt ccttttatga tgatgcccca ccctctaatt cctgtcagcc tacctccagc atctgtcacc atggcaatga gccagatgaa ccacctcagc accattgcaa atatggcagc agcagcacaa gttcagagtc ccccatccag agttgagaca tcagttatta aggagcgtgt tcctgatagc ccctcacctg ccccctctct ggaggagggg agaaggcctg gcagtcaccc atcatcacat cgcagcagca gcgtgtccag ctcccctgct cggactgaga gctcttctga cagaatcccg gtccatcaga atgggttgtc catgaaccag atgctgatgg gcttatcacc aaatgtactt cctgggccca aagagggaga tttggccggt catgacatgg gacatgagtc aaaaaggatg catattgaaa aagatgagac cccgctttct acaccaaccg caagagacag ccttgacaaa ctctctctaa ctgggcatgg acaaccactg cctccaggtt ttccatctcc ttttctgttt cctgatggac tgtcttccat cgagactctt ctgactaaca tacaggggct gttgaaagtt gccatagata atgccagagc tcaagagaaa caggtccaac tggaaaaaac tgagctgaag atggattttt taagggaaag agaactaagg gaaacacttg agaagcagtt ggctatggaa caaaagaata gagccatagt tcaaaagagg ctaaagaagg agaagaaggc aaagagaaaa ttgcaggaag cacttgagtt tgagacgaaa cggcgtgaac aagcagaaca gacgctaaaa caggcagctt caacagatag tctcagggtc ttaaatgact ctctgacccc agagatagag gctgaccgca gtggcggcag aacagatgct gaaaggacaa tacaagatgg aagactgtat ttgaaaacta ctgtcatgta ctga. It is sometimes possible for the material contained within the vial of "DACH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.