Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYP1A1 cdna clone

CYP1A1 cDNA Clone

Gene Names
CYP1A1; AHH; AHRR; CP11; CYP1; CYPIA1; P1-450; P450-C; P450DX
Synonyms
CYP1A1; CYP1A1 cDNA Clone; CYP1A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcttttcccaatctccatgtcggccacggagtttcttctggcctctgtcatcttctgtctggtattctgggtaatcagggcctcaagacctcaggtccccaaaggcctgaagaatccaccagggccatggggctggcctctgattgggcacatgctgaccctgggaaagaacccgcacctggcactgtcaaggatgagccagcagtatggggacgtgctgcagatccgaattggctccacacccgtggtggtgctgagcggcctggacaccatccggcaggccctggtgcggcagggcgatgatttcaagggccggcccgacctctacaccttcaccctcatcagtaatggtcagagcatgtccttcagcccagactctggaccagtgtgggctgcccgccggcgcctggcccagaatggcctgaaaagtttctccattgcctctgacccagcctcctcaacctcctgctacctggaagagcatgtgagcaaggaggctgaggtcctgataagcacgttgcaggagctgatggcagggcctgggcactttaacccctacaggtatgtggtggtatcagtgaccaatgtcatctgtgccatttgctttggccggcgctatgaccacaaccaccaagaactgcttagcctagtcaacctgaataataatttcggggaggtggttggctctggaaacccagctgacttcatccctattcttcgctacctacccaacccttccctgaatgccttcaaggacctgaatgagaagttctacagcttcatgcagaagatggtcaaggagcactacaaaacctttgagaagggccacatccgggacatcacagacagcctgattgagcactgtcaggagaagcagctggatgagaacgccaatgtccagctgtcagatgagaagatcattaacatcgtcttggacctctttggagctgggtttgacacagtcacaactgctatctcctggagcctcatgtatttggtgatgaaccccagggtacagagaaagatccaagaggagctagacacagtgattggcaggtcacggcggccccggctctctgacagatcccatctgccctatatggaggccttcatcctggagaccttccgacactcttccttcgtccccttcaccatcccccacagcacaacaagagacacaagtttgaaaggcttttacatccccaaggggcgttgtgtctttgtaaaccagtggcagatcaaccatgaccagaagctatgggtcaacccatctgagttcctacctgaacggtttctcacccctgatggtgctatcgacaaggtgttaagtgagaaggtgattatctttggcatgggcaagcggaagtgtatcggtgagaccattgcccgctgggaggtctttctcttcctggctatcctgctgcaacgggtggaattcagcgtgccactgggcgtgaaggtggacatgacccccatctatgggctaaccatgaagcatgcctgctgtgagcacttccaaatgcagctgcgctcttag
Sequence Length
1539
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,441 Da
NCBI Official Full Name
Homo sapiens cytochrome P450, family 1, subfamily A, polypeptide 1, mRNA
NCBI Official Synonym Full Names
cytochrome P450 family 1 subfamily A member 1
NCBI Official Symbol
CYP1A1
NCBI Official Synonym Symbols
AHH; AHRR; CP11; CYP1; CYPIA1; P1-450; P450-C; P450DX
NCBI Protein Information
cytochrome P450 1A1
UniProt Protein Name
Cytochrome P450 1A1
Protein Family
UniProt Gene Name
CYP1A1
UniProt Entry Name
CP1A1_HUMAN

NCBI Description

This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]

Uniprot Description

CYP1A1: Cytochromes P450 are a group of heme-thiolate monooxygenases. In liver microsomes, this enzyme is involved in an NADPH-dependent electron transport pathway. It oxidizes a variety of structurally unrelated compounds, including steroids, fatty acids, and xenobiotics. Belongs to the cytochrome P450 family.

Protein type: Cofactor and Vitamin Metabolism - retinol; Amino Acid Metabolism - tryptophan; Oxidoreductase; EC 1.14.14.1; Xenobiotic Metabolism - metabolism by cytochrome P450

Chromosomal Location of Human Ortholog: 15q24.1

Cellular Component: endoplasmic reticulum membrane; intracellular membrane-bound organelle

Molecular Function: monooxygenase activity; oxidoreductase activity; oxygen binding; protein binding

Biological Process: drug metabolic process; epoxygenase P450 pathway; ethylene metabolic process; vitamin D metabolic process

Research Articles on CYP1A1

Similar Products

Product Notes

The CYP1A1 cyp1a1 (Catalog #AAA1266071) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttttcc caatctccat gtcggccacg gagtttcttc tggcctctgt catcttctgt ctggtattct gggtaatcag ggcctcaaga cctcaggtcc ccaaaggcct gaagaatcca ccagggccat ggggctggcc tctgattggg cacatgctga ccctgggaaa gaacccgcac ctggcactgt caaggatgag ccagcagtat ggggacgtgc tgcagatccg aattggctcc acacccgtgg tggtgctgag cggcctggac accatccggc aggccctggt gcggcagggc gatgatttca agggccggcc cgacctctac accttcaccc tcatcagtaa tggtcagagc atgtccttca gcccagactc tggaccagtg tgggctgccc gccggcgcct ggcccagaat ggcctgaaaa gtttctccat tgcctctgac ccagcctcct caacctcctg ctacctggaa gagcatgtga gcaaggaggc tgaggtcctg ataagcacgt tgcaggagct gatggcaggg cctgggcact ttaaccccta caggtatgtg gtggtatcag tgaccaatgt catctgtgcc atttgctttg gccggcgcta tgaccacaac caccaagaac tgcttagcct agtcaacctg aataataatt tcggggaggt ggttggctct ggaaacccag ctgacttcat ccctattctt cgctacctac ccaacccttc cctgaatgcc ttcaaggacc tgaatgagaa gttctacagc ttcatgcaga agatggtcaa ggagcactac aaaacctttg agaagggcca catccgggac atcacagaca gcctgattga gcactgtcag gagaagcagc tggatgagaa cgccaatgtc cagctgtcag atgagaagat cattaacatc gtcttggacc tctttggagc tgggtttgac acagtcacaa ctgctatctc ctggagcctc atgtatttgg tgatgaaccc cagggtacag agaaagatcc aagaggagct agacacagtg attggcaggt cacggcggcc ccggctctct gacagatccc atctgcccta tatggaggcc ttcatcctgg agaccttccg acactcttcc ttcgtcccct tcaccatccc ccacagcaca acaagagaca caagtttgaa aggcttttac atccccaagg ggcgttgtgt ctttgtaaac cagtggcaga tcaaccatga ccagaagcta tgggtcaacc catctgagtt cctacctgaa cggtttctca cccctgatgg tgctatcgac aaggtgttaa gtgagaaggt gattatcttt ggcatgggca agcggaagtg tatcggtgag accattgccc gctgggaggt ctttctcttc ctggctatcc tgctgcaacg ggtggaattc agcgtgccac tgggcgtgaa ggtggacatg acccccatct atgggctaac catgaagcat gcctgctgtg agcacttcca aatgcagctg cgctcttag. It is sometimes possible for the material contained within the vial of "CYP1A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.