Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYP17A1 cdna clone

CYP17A1 cDNA Clone

Gene Names
CYP17A1; CPT7; CYP17; S17AH; P450C17
Synonyms
CYP17A1; CYP17A1 cDNA Clone; CYP17A1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgggagctcgtggctctcttgctgcttaccctagcttatttgttttggcccaagagaaggtgccctggtgccaagtaccccaagagcctcctgtccctgcccctggtgggcagcctgccattcctccccagacatggccatatgcataacaacttcttcaagctgcagaaaaaatatggccccatctattctgttcgtatgggcaccaagactacagtgattgtcggccaccaccagctggccaaggaggtgcttattaagaagggcaaggacttctctgggcggcctcaaatggcaactctagacatcgcgtccaacaaccgtaagggtatcgccttcgctgactctggcgcacactggcagctgcatcgaaggctggcgatggccacctttgccctgttcaaggatggcgatcagaagctggagaagatcatttgtcaggaaatcagtacattgtgtgatatgctggccacccacaacggacagtccatagacatctcctttcctgtcttcgtggcggtaaccaatgtcatctccttgatctgcttcaatacctcctacaagaatggggaccctgagttgaatgtcatacagaattacaatgaaggcatcatagacaacctgagcaaagacagcctggtggacctagtcccctggttgaagattttccccaacaaaaccctggaaaaattaaagagccatgttaaaatacgaaatgatctgctgaataaaatacttgaaaattacaaggagaaattccggagtgactctatcaccaacatgctggacacactgatgcaagccaagatgaactcagataatggcaatgctggcccagatcaagactcagagctgctttcagataaccacattctcaccaccataggggacatctttggggctggcgtggagaccaccacctctgtggttaaatggaccctggccttcctgctgcacaatcctcaggtgaagaagaagctctacgaggagattgaccagaatgtgggtttcagccgcacaccaactatcagtgaccgtaaccgtctcctcctgctggaggccaccatccgagaggtgcttcgcctcaggcccgtggcccctatgctcatcccccacaaggccaacgttgactccagcatcggtgagtttgctgtggacaagggcacagaagttatcatcaatctgtgggcgctgcatcacaatgagaaggagtggcaccagccggatcagttcatgcctgagcgtttcttgaatccagcggggacccagctcatctcaccgtcagtaagctatttgcccttcggagcaggacctcgctcctgtataggtgagatcctggcccgccaggagctcttcctcatcatggcctggctgctgcagaggttcgacctggaagtgccagatgatgggcagctgccctccctggaaggcatccccaaggtggtctttctgatcgactctttcaaagtgaagatcaaggtgcgccaggcctggagggaagcccaggctgagggtagcacctaa
Sequence Length
1527
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
57,371 Da
NCBI Official Full Name
Homo sapiens cytochrome P450, family 17, subfamily A, polypeptide 1, mRNA
NCBI Official Synonym Full Names
cytochrome P450 family 17 subfamily A member 1
NCBI Official Symbol
CYP17A1
NCBI Official Synonym Symbols
CPT7; CYP17; S17AH; P450C17
NCBI Protein Information
steroid 17-alpha-hydroxylase/17,20 lyase
UniProt Protein Name
Steroid 17-alpha-hydroxylase/17,20 lyase
UniProt Gene Name
CYP17A1
UniProt Synonym Gene Names
CYP17; S17AH; Cytochrome P450c17
UniProt Entry Name
CP17A_HUMAN

NCBI Description

This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]

Uniprot Description

CYP17A1: Conversion of pregnenolone and progesterone to their 17- alpha-hydroxylated products and subsequently to dehydroepiandrosterone (DHEA) and androstenedione. Catalyzes both the 17-alpha-hydroxylation and the 17,20-lyase reaction. Involved in sexual development during fetal life and at puberty. Defects in CYP17A1 are the cause of adrenal hyperplasia type 5 (AH5). AH5 is a form of congenital adrenal hyperplasia, a common recessive disease due to defective synthesis of cortisol. Congenital adrenal hyperplasia is characterized by androgen excess leading to ambiguous genitalia in affected females, rapid somatic growth during childhood in both sexes with premature closure of the epiphyses and short adult stature. Four clinical types: salt wasting (SW, the most severe type), simple virilizing (SV, less severely affected patients), with normal aldosterone biosynthesis, non-classic form or late onset (NC or LOAH), and cryptic (asymptomatic). Belongs to the cytochrome P450 family.

Protein type: Oxidoreductase; EC 4.1.2.30; Lipid Metabolism - C21-steroid hormone; EC 1.14.99.9

Chromosomal Location of Human Ortholog: 10q24.3

Cellular Component: endoplasmic reticulum membrane

Molecular Function: 17-alpha-hydroxyprogesterone aldolase activity; heme binding; oxygen binding; steroid 17-alpha-monooxygenase activity

Biological Process: androgen biosynthetic process; glucocorticoid biosynthetic process; hormone biosynthetic process; progesterone metabolic process; sex differentiation; steroid biosynthetic process; steroid metabolic process; sterol metabolic process

Disease: Adrenal Hyperplasia, Congenital, Due To 17-alpha-hydroxylase Deficiency

Research Articles on CYP17A1

Similar Products

Product Notes

The CYP17A1 cyp17a1 (Catalog #AAA1273329) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgggagc tcgtggctct cttgctgctt accctagctt atttgttttg gcccaagaga aggtgccctg gtgccaagta ccccaagagc ctcctgtccc tgcccctggt gggcagcctg ccattcctcc ccagacatgg ccatatgcat aacaacttct tcaagctgca gaaaaaatat ggccccatct attctgttcg tatgggcacc aagactacag tgattgtcgg ccaccaccag ctggccaagg aggtgcttat taagaagggc aaggacttct ctgggcggcc tcaaatggca actctagaca tcgcgtccaa caaccgtaag ggtatcgcct tcgctgactc tggcgcacac tggcagctgc atcgaaggct ggcgatggcc acctttgccc tgttcaagga tggcgatcag aagctggaga agatcatttg tcaggaaatc agtacattgt gtgatatgct ggccacccac aacggacagt ccatagacat ctcctttcct gtcttcgtgg cggtaaccaa tgtcatctcc ttgatctgct tcaatacctc ctacaagaat ggggaccctg agttgaatgt catacagaat tacaatgaag gcatcataga caacctgagc aaagacagcc tggtggacct agtcccctgg ttgaagattt tccccaacaa aaccctggaa aaattaaaga gccatgttaa aatacgaaat gatctgctga ataaaatact tgaaaattac aaggagaaat tccggagtga ctctatcacc aacatgctgg acacactgat gcaagccaag atgaactcag ataatggcaa tgctggccca gatcaagact cagagctgct ttcagataac cacattctca ccaccatagg ggacatcttt ggggctggcg tggagaccac cacctctgtg gttaaatgga ccctggcctt cctgctgcac aatcctcagg tgaagaagaa gctctacgag gagattgacc agaatgtggg tttcagccgc acaccaacta tcagtgaccg taaccgtctc ctcctgctgg aggccaccat ccgagaggtg cttcgcctca ggcccgtggc ccctatgctc atcccccaca aggccaacgt tgactccagc atcggtgagt ttgctgtgga caagggcaca gaagttatca tcaatctgtg ggcgctgcat cacaatgaga aggagtggca ccagccggat cagttcatgc ctgagcgttt cttgaatcca gcggggaccc agctcatctc accgtcagta agctatttgc ccttcggagc aggacctcgc tcctgtatag gtgagatcct ggcccgccag gagctcttcc tcatcatggc ctggctgctg cagaggttcg acctggaagt gccagatgat gggcagctgc cctccctgga aggcatcccc aaggtggtct ttctgatcga ctctttcaaa gtgaagatca aggtgcgcca ggcctggagg gaagcccagg ctgagggtag cacctaa. It is sometimes possible for the material contained within the vial of "CYP17A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.