Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYLC1 cdna clone

CYLC1 cDNA Clone

Gene Names
CYLC1; CYCL1
Synonyms
CYLC1; CYLC1 cDNA Clone; CYLC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcttccaaggttgctaaaagtaaacatcagaacatatgataattccattccaatcagtgaatcaagcagaaaatcatggaatcaaaaacactttgctttgacatttcccaaaccactccagagaggtacaaatgataaatcaagacctttgaaatcacaaataacagttactagacatgacaaaagaaaactagaagaaggccagaaaccagctcataaatggataaggcattctttcagaaaaattttgcaatggccacccatttacacagctgccagggaacagactccattcagacatctttatacttccaaaacccatcttaaaaaagcagaatataaaaagtccaaagatgaaaaaggaggaacacctttgaagaaagattccaagaaaaaaggaggttcatatgcaacaaatccagaatccaagcaaatagtagaagagaaaactaaaagacaaaatgaggcagataaaactcccttaaaatcatcacatgaaaatgaacaatccaagaagtcaaaatccagttcagaaactaatccagaatcccaaaattctaagacagtctcaaaaaattgttcacaaaaagataagaaagattcaaagaattccaagaagacaaacactgaattcctacatacaaagaacaatccaaagaaagatttgaagaggtcaaagactagtaatgatcccatatcagagatttgctcagaaaatagtttaaatgttgatttcctcatgttagtgggacagtctgatgatgaatccataaattttgatgcatggttaaggaattactcacagaataattcaaagaattattctttgaagtatacaaagtatacaaagaaggacacaaaaaagaatgcaaagaaaagctctgatgctgaatctgaagactcaaaggatgctaagaaagattcaaagaaagttaagaaaaatgtcaagaaagatgacaagaaaaaggatgtaaagaaggacacagagtctactgatgctgaatctggagactcaaaggatgaaaggaaagatacaaagaaggataagaaaaaattaaagaaagatgacaagaaaaaggacacaaagaagtacccagagtctactgatactgaatcaggagatgcaaaggatgcaagaaatgattcaagaaatttgaagaaagcttcaaagaatgatgacaagaaaaaggatgcaaagaaaattacattctctactgattctgaatctgaactggagtcaaaggagagtcagaaagatgaaaaaaaggataaaaaagattcaaagacagataataaaaagtctgtcaagaatgatgaagagtctactgatgctgactctgaaccgaagggagattcaaaaaagggtaaaaaggatgaaaagaaggggaagaaagattcaaagaaagatgacaaaaagaaggatgcaaagaaaaatgcagaatctactgaaatggaatctgatttggagttaaagaaggacaagaaacactcaaaggaaaagaaaggttcaaagaaagatatcaagaaggatgcaagaaaggacacagagtctactgatgctgaatttgatgaatcttccaagacaggctttaaaacatctacaaaaatcaaaggttcagatactgaatctgaagagtcactatataaacctggggctaagaagaaaattgatgaatcagatggcacatctgcaaattcaaagatggaaggactggaatcaaagagaggattcagaatgtcatccaaaaagactacattcaatgaaaaaggggaaaaagcaagtacaggtagagttcctccatcaagagaaaaaccaccactccctgcttgtgagccttctctaccatcaccaaaggtcagacgtctttgttggtgcaagatgcctcctccacctccaaaaccaagatatgctcctttgcctgaagcaccgtggattcataagctgctttaa
Sequence Length
1956
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,242 Da
NCBI Official Full Name
Homo sapiens cylicin, basic protein of sperm head cytoskeleton 1, mRNA
NCBI Official Synonym Full Names
cylicin 1
NCBI Official Symbol
CYLC1
NCBI Official Synonym Symbols
CYCL1
NCBI Protein Information
cylicin-1
UniProt Protein Name
Cylicin-1
Protein Family
UniProt Gene Name
CYLC1
UniProt Synonym Gene Names
CYL; CYL1
UniProt Entry Name
CYLC1_HUMAN

NCBI Description

This gene encodes a sperm head cytoskeletal protein. The encoded protein is associated with the calyx of spermatozoa and spermatids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]

Uniprot Description

CYLC1: Possible architectural role during spermatogenesis. May be involved in spermatid differentiation.

Protein type: Cytoskeletal; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: Xq21.1

Cellular Component: acrosomal matrix; nucleus

Research Articles on CYLC1

Similar Products

Product Notes

The CYLC1 cylc1 (Catalog #AAA1273533) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcttc caaggttgct aaaagtaaac atcagaacat atgataattc cattccaatc agtgaatcaa gcagaaaatc atggaatcaa aaacactttg ctttgacatt tcccaaacca ctccagagag gtacaaatga taaatcaaga cctttgaaat cacaaataac agttactaga catgacaaaa gaaaactaga agaaggccag aaaccagctc ataaatggat aaggcattct ttcagaaaaa ttttgcaatg gccacccatt tacacagctg ccagggaaca gactccattc agacatcttt atacttccaa aacccatctt aaaaaagcag aatataaaaa gtccaaagat gaaaaaggag gaacaccttt gaagaaagat tccaagaaaa aaggaggttc atatgcaaca aatccagaat ccaagcaaat agtagaagag aaaactaaaa gacaaaatga ggcagataaa actcccttaa aatcatcaca tgaaaatgaa caatccaaga agtcaaaatc cagttcagaa actaatccag aatcccaaaa ttctaagaca gtctcaaaaa attgttcaca aaaagataag aaagattcaa agaattccaa gaagacaaac actgaattcc tacatacaaa gaacaatcca aagaaagatt tgaagaggtc aaagactagt aatgatccca tatcagagat ttgctcagaa aatagtttaa atgttgattt cctcatgtta gtgggacagt ctgatgatga atccataaat tttgatgcat ggttaaggaa ttactcacag aataattcaa agaattattc tttgaagtat acaaagtata caaagaagga cacaaaaaag aatgcaaaga aaagctctga tgctgaatct gaagactcaa aggatgctaa gaaagattca aagaaagtta agaaaaatgt caagaaagat gacaagaaaa aggatgtaaa gaaggacaca gagtctactg atgctgaatc tggagactca aaggatgaaa ggaaagatac aaagaaggat aagaaaaaat taaagaaaga tgacaagaaa aaggacacaa agaagtaccc agagtctact gatactgaat caggagatgc aaaggatgca agaaatgatt caagaaattt gaagaaagct tcaaagaatg atgacaagaa aaaggatgca aagaaaatta cattctctac tgattctgaa tctgaactgg agtcaaagga gagtcagaaa gatgaaaaaa aggataaaaa agattcaaag acagataata aaaagtctgt caagaatgat gaagagtcta ctgatgctga ctctgaaccg aagggagatt caaaaaaggg taaaaaggat gaaaagaagg ggaagaaaga ttcaaagaaa gatgacaaaa agaaggatgc aaagaaaaat gcagaatcta ctgaaatgga atctgatttg gagttaaaga aggacaagaa acactcaaag gaaaagaaag gttcaaagaa agatatcaag aaggatgcaa gaaaggacac agagtctact gatgctgaat ttgatgaatc ttccaagaca ggctttaaaa catctacaaa aatcaaaggt tcagatactg aatctgaaga gtcactatat aaacctgggg ctaagaagaa aattgatgaa tcagatggca catctgcaaa ttcaaagatg gaaggactgg aatcaaagag aggattcaga atgtcatcca aaaagactac attcaatgaa aaaggggaaa aagcaagtac aggtagagtt cctccatcaa gagaaaaacc accactccct gcttgtgagc cttctctacc atcaccaaag gtcagacgtc tttgttggtg caagatgcct cctccacctc caaaaccaag atatgctcct ttgcctgaag caccgtggat tcataagctg ctttaa. It is sometimes possible for the material contained within the vial of "CYLC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.