Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXCR3 cdna clone

CXCR3 cDNA Clone

Gene Names
CXCR3; GPR9; MigR; CD182; CD183; Mig-R; CKR-L2; CMKAR3; IP10-R
Synonyms
CXCR3; CXCR3 cDNA Clone; CXCR3 cdna clone
Ordering
For Research Use Only!
Sequence
atggtccttgaggtgagtgaccaccaagtgctaaatgacgccgaggttgccgccctcctggagaacttcagctcttcctatgactatggagaaaacgagagtgactcgtgctgtacctccccgccctgcccacaggacttcagcctgaacttcgaccgggccttcctgccagccctctacagcctcctctttctgctggggctgctgggcaacggcgcggtggcagccgtgctgctgagccggcggacagccctgagcagcaccgacaccttcctgctccacctagctgtagcagacacgctgctggtgctgacactgccgctctgggcagtggacgctgccgtccagtgggtctttggctctggcctctgcaaagtggcaggtgccctcttcaacatcaacttctacgcaggagccctcctgctggcctgcatcagctttgaccgctacctgaacatagttcatgccacccagctctaccgccgggggcccccggcccgcgtgaccctcacctgcctggctgtctgggggctctgcctgcttttcgccctcccagacttcatcttcctgtcggcccaccacgacgagcgcctcaacgccacccactgccaatacaacttcccacaggtgggccgcacggctctgcgggtgctgcagctggtggctggctttctgctgcccctgctggtcatggcctactgctatgcccacatcctggccgtgctgctggtttccaggggccagcggcgcctgcgggccatgcggctggtggtggtggtcgtggtggcctttgccctctgctggaccccctatcacctggtggtgctggtggacatcctcatggacctgggcgctttggcccgcaactgtggccgagaaagcagggtagacgtggccaagtcggtcacctcaggcctgggctacatgcactgctgcctcaacccgctgctctatgcctttgtaggggtcaagttccgggagcggatgtggatgctgctcttgcgcctgggctgccccaaccagagagggctccagaggcagccatcgtcttcccgccgggattcatcctggtctgagacctcagaggcctcctactcgggcttgtga
Sequence Length
1107
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,715 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X-C motif) receptor 3, mRNA
NCBI Official Synonym Full Names
C-X-C motif chemokine receptor 3
NCBI Official Symbol
CXCR3
NCBI Official Synonym Symbols
GPR9; MigR; CD182; CD183; Mig-R; CKR-L2; CMKAR3; IP10-R
NCBI Protein Information
C-X-C chemokine receptor type 3
UniProt Protein Name
C-X-C chemokine receptor type 3
Protein Family
UniProt Gene Name
CXCR3
UniProt Synonym Gene Names
GPR9; CXC-R3; CXCR-3; IP-10 receptor
UniProt Entry Name
CXCR3_HUMAN

NCBI Description

This gene encodes a G protein-coupled receptor with selectivity for three chemokines, termed CXCL9/Mig (monokine induced by interferon-g), CXCL10/IP10 (interferon-g-inducible 10 kDa protein) and CXCL11/I-TAC (interferon-inducible T cell a-chemoattractant). Binding of chemokines to this protein induces cellular responses that are involved in leukocyte traffic, most notably integrin activation, cytoskeletal changes and chemotactic migration. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One of the isoforms (CXCR3-B) shows high affinity binding to chemokine, CXCL4/PF4 (PMID:12782716). [provided by RefSeq, Jun 2011]

Uniprot Description

CXCR3: Receptor for CXCL9, CXCL10 and CXCL11 and mediates the proliferation of human mesangial cells (HMC). Belongs to the G-protein coupled receptor 1 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Receptor, GPCR; GPCR, family 1

Chromosomal Location of Human Ortholog: Xq13

Cellular Component: cytoplasm; integral to plasma membrane; plasma membrane

Molecular Function: chemokine binding; chemokine receptor activity

Biological Process: cell adhesion; cell motility; cell surface receptor linked signal transduction; chemotaxis

Research Articles on CXCR3

Similar Products

Product Notes

The CXCR3 cxcr3 (Catalog #AAA1275541) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtccttg aggtgagtga ccaccaagtg ctaaatgacg ccgaggttgc cgccctcctg gagaacttca gctcttccta tgactatgga gaaaacgaga gtgactcgtg ctgtacctcc ccgccctgcc cacaggactt cagcctgaac ttcgaccggg ccttcctgcc agccctctac agcctcctct ttctgctggg gctgctgggc aacggcgcgg tggcagccgt gctgctgagc cggcggacag ccctgagcag caccgacacc ttcctgctcc acctagctgt agcagacacg ctgctggtgc tgacactgcc gctctgggca gtggacgctg ccgtccagtg ggtctttggc tctggcctct gcaaagtggc aggtgccctc ttcaacatca acttctacgc aggagccctc ctgctggcct gcatcagctt tgaccgctac ctgaacatag ttcatgccac ccagctctac cgccgggggc ccccggcccg cgtgaccctc acctgcctgg ctgtctgggg gctctgcctg cttttcgccc tcccagactt catcttcctg tcggcccacc acgacgagcg cctcaacgcc acccactgcc aatacaactt cccacaggtg ggccgcacgg ctctgcgggt gctgcagctg gtggctggct ttctgctgcc cctgctggtc atggcctact gctatgccca catcctggcc gtgctgctgg tttccagggg ccagcggcgc ctgcgggcca tgcggctggt ggtggtggtc gtggtggcct ttgccctctg ctggaccccc tatcacctgg tggtgctggt ggacatcctc atggacctgg gcgctttggc ccgcaactgt ggccgagaaa gcagggtaga cgtggccaag tcggtcacct caggcctggg ctacatgcac tgctgcctca acccgctgct ctatgccttt gtaggggtca agttccggga gcggatgtgg atgctgctct tgcgcctggg ctgccccaac cagagagggc tccagaggca gccatcgtct tcccgccggg attcatcctg gtctgagacc tcagaggcct cctactcggg cttgtga. It is sometimes possible for the material contained within the vial of "CXCR3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.