Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXCL16 cdna clone

CXCL16 cDNA Clone

Gene Names
CXCL16; SRPSOX; CXCLG16; SR-PSOX
Synonyms
CXCL16; CXCL16 cDNA Clone; CXCL16 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgggagtcagagcgaggtggctccatccccgcagagtccgcggagccccgagatgggacgggacttgcggcccgggtcccgcgtgctcctgctcctgcttctgctcctgctggtgtacctgactcagccaggcaatggcaacgagggcagcgtcactggaagttgttattgtggtaaaagaatttcttccgactccccgccatcggttcagttcatgaatcgtctccggaaacacctgagagcttaccatcggtgtctatactacacgaggttccagctcctttcctggagcgtgtgtggaggcaacaaggacccatgggttcaggaattgatgagctgtcttgatctcaaagaatgtggacatgcttactcggggattgtggcccaccagaagcatttacttcctaccagccccccaacttctcaggcctcagagggggcatcttcagatatccacacccctgcccagatgctcctgtccaccttgcagtccactcagcgccccaccctcccagtaggatcactgtcctcggacaaagagctcactcgtcccaatgaaaccaccattcacactgcgggccacagtctggcagttgggcctgaggctggggagaaccagaagcagccggaaaaaaatgctggtcccacagccaggacatcagccacagtgccggtcctgtgcctcctggccatcatcttcatcctcaccgcagccctttcctatgtgctgtgcaagaggaggagggggcagtcaccgcagtcctctccagatctgccggttcattatatacctgtggcacctgactctaatacctga
Sequence Length
822
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,579 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X-C motif) ligand 16, mRNA
NCBI Official Synonym Full Names
C-X-C motif chemokine ligand 16
NCBI Official Symbol
CXCL16
NCBI Official Synonym Symbols
SRPSOX; CXCLG16; SR-PSOX
NCBI Protein Information
C-X-C motif chemokine 16
UniProt Protein Name
C-X-C motif chemokine 16
Protein Family
UniProt Gene Name
CXCL16
UniProt Synonym Gene Names
SCYB16; SRPSOX; SR-PSOX
UniProt Entry Name
CXL16_HUMAN

Uniprot Description

CXCL16: Acts as a scavenger receptor on macrophages, which specifically binds to OxLDL (oxidized low density lipoprotein), suggesting that it may be involved in pathophysiology such as atherogenesis. Induces a strong chemotactic response. Induces calcium mobilization. Binds to CXCR6/Bonzo. Belongs to the intercrine alpha (chemokine CxC) family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 17p13

Cellular Component: extracellular region; extracellular space; membrane

Molecular Function: chemokine activity; low-density lipoprotein receptor activity; scavenger receptor activity

Biological Process: positive regulation of cell growth; positive regulation of cell migration; response to cytokine stimulus

Research Articles on CXCL16

Similar Products

Product Notes

The CXCL16 cxcl16 (Catalog #AAA1267178) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctggga gtcagagcga ggtggctcca tccccgcaga gtccgcggag ccccgagatg ggacgggact tgcggcccgg gtcccgcgtg ctcctgctcc tgcttctgct cctgctggtg tacctgactc agccaggcaa tggcaacgag ggcagcgtca ctggaagttg ttattgtggt aaaagaattt cttccgactc cccgccatcg gttcagttca tgaatcgtct ccggaaacac ctgagagctt accatcggtg tctatactac acgaggttcc agctcctttc ctggagcgtg tgtggaggca acaaggaccc atgggttcag gaattgatga gctgtcttga tctcaaagaa tgtggacatg cttactcggg gattgtggcc caccagaagc atttacttcc taccagcccc ccaacttctc aggcctcaga gggggcatct tcagatatcc acacccctgc ccagatgctc ctgtccacct tgcagtccac tcagcgcccc accctcccag taggatcact gtcctcggac aaagagctca ctcgtcccaa tgaaaccacc attcacactg cgggccacag tctggcagtt gggcctgagg ctggggagaa ccagaagcag ccggaaaaaa atgctggtcc cacagccagg acatcagcca cagtgccggt cctgtgcctc ctggccatca tcttcatcct caccgcagcc ctttcctatg tgctgtgcaa gaggaggagg gggcagtcac cgcagtcctc tccagatctg ccggttcatt atatacctgt ggcacctgac tctaatacct ga. It is sometimes possible for the material contained within the vial of "CXCL16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.