Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXCL11 cdna clone

CXCL11 cDNA Clone

Gene Names
CXCL11; IP9; H174; IP-9; b-R1; I-TAC; SCYB11; SCYB9B
Synonyms
CXCL11; CXCL11 cDNA Clone; CXCL11 cdna clone
Ordering
For Research Use Only!
Sequence
atgagtgtgaagggcatggctatagccttggctgtgatattgtgtgctacagttgttcaaggcttccccatgttcaaaagaggacgctgtctttgcataggccctggggtaaaagcagtgaaagtggcagatattgagaaagcctccataatgtacccaagtaacaactgtgacaaaatagaagtgattattaccctgaaagaaaataaaggacaacgatgcctaaaccccaaatcgaagcaagcaaggcttataatcaaaaaagttgaaagaaagaatttttaa
Sequence Length
285
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,365 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X-C motif) ligand 11, mRNA
NCBI Official Synonym Full Names
C-X-C motif chemokine ligand 11
NCBI Official Symbol
CXCL11
NCBI Official Synonym Symbols
IP9; H174; IP-9; b-R1; I-TAC; SCYB11; SCYB9B
NCBI Protein Information
C-X-C motif chemokine 11
UniProt Protein Name
C-X-C motif chemokine 11
Protein Family
UniProt Gene Name
CXCL11
UniProt Synonym Gene Names
ITAC; SCYB11; SCYB9B; IP-9; I-TAC
UniProt Entry Name
CXL11_HUMAN

NCBI Description

Chemokines are a group of small (approximately 8 to 14 kD), mostly basic, structurally related molecules that regulate cell trafficking of various types of leukocytes through interactions with a subset of 7-transmembrane, G protein-coupled receptors. Chemokines also play fundamental roles in the development, homeostasis, and function of the immune system, and they have effects on cells of the central nervous system as well as on endothelial cells involved in angiogenesis or angiostasis. Chemokines are divided into 2 major subfamilies, CXC and CC. This antimicrobial gene is a CXC member of the chemokine superfamily. Its encoded protein induces a chemotactic response in activated T-cells and is the dominant ligand for CXC receptor-3. The gene encoding this protein contains 4 exons and at least three polyadenylation signals which might reflect cell-specific regulation of expression. IFN-gamma is a potent inducer of transcription of this gene. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2014]

Uniprot Description

CXCL11: Chemotactic for interleukin-activated T-cells but not unstimulated T-cells, neutrophils or monocytes. Induces calcium release in activated T-cells. Binds to CXCR3. May play an important role in CNS diseases which involve T-cell recruitment. May play a role in skin immune responses. Belongs to the intercrine alpha (chemokine CxC) family.

Protein type: Secreted; Chemokine; Secreted, signal peptide; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 4q21.2

Cellular Component: extracellular region; extracellular space

Molecular Function: chemokine activity; CXCR3 chemokine receptor binding; heparin binding; protein binding

Biological Process: cell-cell signaling; chemotaxis; G-protein coupled receptor protein signaling pathway; immune response; positive regulation of cAMP metabolic process; positive regulation of leukocyte chemotaxis; positive regulation of release of sequestered calcium ion into cytosol; regulation of cell proliferation; response to lipopolysaccharide; signal transduction

Research Articles on CXCL11

Similar Products

Product Notes

The CXCL11 cxcl11 (Catalog #AAA1268498) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtgtga agggcatggc tatagccttg gctgtgatat tgtgtgctac agttgttcaa ggcttcccca tgttcaaaag aggacgctgt ctttgcatag gccctggggt aaaagcagtg aaagtggcag atattgagaa agcctccata atgtacccaa gtaacaactg tgacaaaata gaagtgatta ttaccctgaa agaaaataaa ggacaacgat gcctaaaccc caaatcgaag caagcaaggc ttataatcaa aaaagttgaa agaaagaatt tttaa. It is sometimes possible for the material contained within the vial of "CXCL11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.