Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CXCL1 cdna clone

CXCL1 cDNA Clone

Gene Names
CXCL1; FSP; GRO1; GROa; MGSA; NAP-3; SCYB1; MGSA-a
Synonyms
CXCL1; CXCL1 cDNA Clone; CXCL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccgcgctgctctctccgccgcccccagcaatccccggctcctgcgagtggcactgctgctcctgctcctggtagccgctggccggcgcgcagcaggagcgtccgtggccactgaactgcgctgccagtgcttgcagaccctgcagggaattcaccccaagaacatccaaagtgtgaacgtgaagtcccccggaccccactgcgcccaaaccgaagtcatagccacactcaagaatgggcggaaagcttgcctcaatcctgcatcccccatagttaagaaaatcatcgaaaagatgctgaacagtgacaaatccaactga
Sequence Length
324
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,301 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X-C motif) ligand 1 (melanoma growth stimulating activity, alpha), mRNA
NCBI Official Synonym Full Names
C-X-C motif chemokine ligand 1
NCBI Official Symbol
CXCL1
NCBI Official Synonym Symbols
FSP; GRO1; GROa; MGSA; NAP-3; SCYB1; MGSA-a
NCBI Protein Information
growth-regulated alpha protein
UniProt Protein Name
Growth-regulated alpha protein
UniProt Gene Name
CXCL1
UniProt Synonym Gene Names
GRO; GRO1; GROA; MGSA; SCYB1; MGSA; NAP-3
UniProt Entry Name
GROA_HUMAN

NCBI Description

This antimicrobial gene encodes a member of the CXC subfamily of chemokines. The encoded protein is a secreted growth factor that signals through the G-protein coupled receptor, CXC receptor 2. This protein plays a role in inflammation and as a chemoattractant for neutrophils. Aberrant expression of this protein is associated with the growth and progression of certain tumors. A naturally occurring processed form of this protein has increased chemotactic activity. Alternate splicing results in coding and non-coding variants of this gene. A pseudogene of this gene is found on chromosome 4. [provided by RefSeq, Sep 2014]

Uniprot Description

CXCL1: Has chemotactic activity for neutrophils. May play a role in inflammation and exerts its effects on endothelial cells in an autocrine fashion. In vitro, the processed forms GRO- alpha(4-73), GRO-alpha(5-73) and GRO-alpha(6-73) show a 30-fold higher chemotactic activity. Belongs to the intercrine alpha (chemokine CxC) family.

Protein type: Secreted; Motility/polarity/chemotaxis; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 4q21

Cellular Component: extracellular region

Molecular Function: CXCR chemokine receptor binding; enzyme activator activity; receptor binding

Biological Process: actin cytoskeleton organization and biogenesis; cell proliferation; chemotaxis; G-protein coupled receptor protein signaling pathway; immune response; negative regulation of cell proliferation; nervous system development; response to lipopolysaccharide; signal transduction

Research Articles on CXCL1

Similar Products

Product Notes

The CXCL1 cxcl1 (Catalog #AAA1274034) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccgcg ctgctctctc cgccgccccc agcaatcccc ggctcctgcg agtggcactg ctgctcctgc tcctggtagc cgctggccgg cgcgcagcag gagcgtccgt ggccactgaa ctgcgctgcc agtgcttgca gaccctgcag ggaattcacc ccaagaacat ccaaagtgtg aacgtgaagt cccccggacc ccactgcgcc caaaccgaag tcatagccac actcaagaat gggcggaaag cttgcctcaa tcctgcatcc cccatagtta agaaaatcat cgaaaagatg ctgaacagtg acaaatccaa ctga. It is sometimes possible for the material contained within the vial of "CXCL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.