Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CX3CR1 cdna clone

CX3CR1 cDNA Clone

Gene Names
CX3CR1; V28; CCRL1; GPR13; CMKDR1; GPRV28; CMKBRL1
Synonyms
CX3CR1; CX3CR1 cDNA Clone; CX3CR1 cdna clone
Ordering
For Research Use Only!
Sequence
atggatcagttccctgaatcagtgacagaaaactttgagtacgatgatttggctgaggcctgttatattggggacatcgtggtctttgggactgtgttcctgtccatattctactccgtcatctttgccattggcctggtgggaaatttgttggtagtgtttgccctcaccaacagcaagaagcccaagagtgtcaccgacatttacctcctgaacctggccttgtctgatctgctgtttgtagccactttgcccttctggactcactatttgataaatgaaaagggcctccacaatgccatgtgcaaattcactaccgccttcttcttcatcggcttttttggaagcatattcttcatcaccgtcatcagcattgataggtacctggccatcgtcctggccgccaactccatgaacaaccggaccgtgcagcatggcgtcaccatcagcctaggcgtctgggcagcagccattttggtggcagcaccccagttcatgttcacaaagcagaaagaaaatgaatgccttggtgactaccccgaggtcctccaggaaatctggcccgtgctccgcaatgtggaaacaaattttcttggcttcctactccccctgctcattatgagttattgctacttcagaatcatccagacgctgttttcctgcaagaaccacaagaaagccaaagccattaaactgatccttctggtggtcatcgtgtttttcctcttctggacaccctacaacgttatgattttcctggagacgcttaagctctatgacttctttcccagttgtgacatgaggaaggatctgaggctggccctcagtgtgactgagacggttgcatttagccattgttgcctgaatcctctcatctatgcatttgctggggagaagttcagaagatacctttaccacctgtatgggaaatgcctggctgtcctgtgtgggcgctcagtccacgttgatttctcctcatctgaatcacaaaggagcaggcatggaagtgttctgagcagcaattttacttaccacacgagtgatggagatgcattgctccttctctga
Sequence Length
1068
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,969 Da
NCBI Official Full Name
Homo sapiens chemokine (C-X3-C motif) receptor 1, mRNA
NCBI Official Synonym Full Names
C-X3-C motif chemokine receptor 1
NCBI Official Symbol
CX3CR1
NCBI Official Synonym Symbols
V28; CCRL1; GPR13; CMKDR1; GPRV28; CMKBRL1
NCBI Protein Information
CX3C chemokine receptor 1
UniProt Protein Name
CX3C chemokine receptor 1
Protein Family
UniProt Gene Name
CX3CR1
UniProt Synonym Gene Names
CMKBRL1; GPR13; C-X3-C CKR-1; CX3CR1; CMK-BRL1
UniProt Entry Name
CX3C1_HUMAN

NCBI Description

Fractalkine is a transmembrane protein and chemokine involved in the adhesion and migration of leukocytes. The protein encoded by this gene is a receptor for fractalkine. The encoded protein also is a coreceptor for HIV-1, and some variations in this gene lead to increased susceptibility to HIV-1 infection and rapid progression to AIDS. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]

Uniprot Description

CX3CR1: Receptor for the CX3C chemokine fractalkine and mediates both its adhesive and migratory functions. Acts as coreceptor with CD4 for HIV-1 virus envelope protein (in vitro). Isoform 2 and isoform 3 seem to be more potent HIV-1 coreceptors than isoform 1. Defects in CX3CR1 are a cause of susceptibility to age- related macular degeneration type 12 (ARMD12). ARMD12 is a form of age-related macular degeneration, a multifactorial eye disease and the most common cause of irreversible vision loss in the developed world. In most patients, the disease is manifest as ophthalmoscopically visible yellowish accumulations of protein and lipid that lie beneath the retinal pigment epithelium and within an elastin-containing structure known as Bruch membrane. Belongs to the G-protein coupled receptor 1 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell adhesion; Receptor, GPCR; Membrane protein, multi-pass; Motility/polarity/chemotaxis; GPCR, family 1; Receptor, cytokine; Membrane protein, integral

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: C-X3-C chemokine binding; chemokine receptor activity; protein binding

Biological Process: cellular defense response; chemotaxis; response to wounding

Disease: Coronary Heart Disease, Susceptibility To, 1; Human Immunodeficiency Virus Type 1, Susceptibility To; Macular Degeneration, Age-related, 12

Research Articles on CX3CR1

Similar Products

Product Notes

The CX3CR1 cx3cr1 (Catalog #AAA1270108) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcagt tccctgaatc agtgacagaa aactttgagt acgatgattt ggctgaggcc tgttatattg gggacatcgt ggtctttggg actgtgttcc tgtccatatt ctactccgtc atctttgcca ttggcctggt gggaaatttg ttggtagtgt ttgccctcac caacagcaag aagcccaaga gtgtcaccga catttacctc ctgaacctgg ccttgtctga tctgctgttt gtagccactt tgcccttctg gactcactat ttgataaatg aaaagggcct ccacaatgcc atgtgcaaat tcactaccgc cttcttcttc atcggctttt ttggaagcat attcttcatc accgtcatca gcattgatag gtacctggcc atcgtcctgg ccgccaactc catgaacaac cggaccgtgc agcatggcgt caccatcagc ctaggcgtct gggcagcagc cattttggtg gcagcacccc agttcatgtt cacaaagcag aaagaaaatg aatgccttgg tgactacccc gaggtcctcc aggaaatctg gcccgtgctc cgcaatgtgg aaacaaattt tcttggcttc ctactccccc tgctcattat gagttattgc tacttcagaa tcatccagac gctgttttcc tgcaagaacc acaagaaagc caaagccatt aaactgatcc ttctggtggt catcgtgttt ttcctcttct ggacacccta caacgttatg attttcctgg agacgcttaa gctctatgac ttctttccca gttgtgacat gaggaaggat ctgaggctgg ccctcagtgt gactgagacg gttgcattta gccattgttg cctgaatcct ctcatctatg catttgctgg ggagaagttc agaagatacc tttaccacct gtatgggaaa tgcctggctg tcctgtgtgg gcgctcagtc cacgttgatt tctcctcatc tgaatcacaa aggagcaggc atggaagtgt tctgagcagc aattttactt accacacgag tgatggagat gcattgctcc ttctctga. It is sometimes possible for the material contained within the vial of "CX3CR1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.