Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CUTC cdna clone

CUTC cDNA Clone

Gene Names
CUTC; CGI-32
Synonyms
CUTC; CUTC cDNA Clone; CUTC cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaaggcagggggcctcctctgagcgaaaacgagcgcggataccgtccgggaaggccggagcagcaaatggatttctcatggaagtttgtgttgattcagtggaatcagctgtgaatgcagaaagaggaggtgctgatcggattgaattatgttctggtttatcagaggggggaactacacccagcatgggtgtccttcaagtagtgaagcagagtgttcagatcccagtttttgtgatgattcggccacggggaggtgattttttgtattcagatcgtgaaattgaggtgatgaaggctgacattcgtcttgccaagctttatggtgctgatggtttggtttttggggcattgactgaagatggacacattgacaaagagctgtgtatgtcccttatggctatttgccgccctctgccagtcactttccaccgagcctttgacatggttcatgatccaatggcagctctggagaccctcttaaccttgggatttgaacgcgtgttgaccagtggatgtgacagttcagcattagaagggctacccctaataaagcgactcattgagcaggcaaaaggcaggattgtggtaatgccaggaggtggtataacagacagaaatctacaaaggatccttgagggttcaggtgctacagaattccactgttctgctcggtctactagagactcgggaatgaagtttcgaaattcatctgttgccatgggagcctcactttcttgctcagaatattccctaaaggtaacagatgtgaccaaagtaaggactttgaatgctatcgcaaagaacatcctggtgtag
Sequence Length
822
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,341 Da
NCBI Official Full Name
Homo sapiens cutC copper transporter homolog (E. coli), mRNA
NCBI Official Synonym Full Names
cutC copper transporter
NCBI Official Symbol
CUTC
NCBI Official Synonym Symbols
CGI-32
NCBI Protein Information
copper homeostasis protein cutC homolog
UniProt Protein Name
Copper homeostasis protein cutC homolog
Protein Family
UniProt Gene Name
CUTC
UniProt Entry Name
CUTC_HUMAN

NCBI Description

Members of the CUT family of copper transporters are associated with copper homeostasis and are involved in the uptake, storage, delivery, and efflux of copper (Gupta et al., 1995 [PubMed 7635807]; Li et al., 2005 [PubMed 16182249]).[supplied by OMIM, Mar 2008]

Uniprot Description

CUTC: a copper binding protein associated with copper homeostasis and transport. Widely expressed in human tissues. Its nuclear and cytoplasmic distribution suggests that it may be a nucleocytoplasmic copper ion shuttle protein.

Protein type: Carrier

Chromosomal Location of Human Ortholog: 10q24.2

Cellular Component: cytoplasm; nucleolus; nucleus

Molecular Function: copper ion binding; protein binding

Biological Process: protein tetramerization

Research Articles on CUTC

Similar Products

Product Notes

The CUTC cutc (Catalog #AAA1271093) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaaggc agggggcctc ctctgagcga aaacgagcgc ggataccgtc cgggaaggcc ggagcagcaa atggatttct catggaagtt tgtgttgatt cagtggaatc agctgtgaat gcagaaagag gaggtgctga tcggattgaa ttatgttctg gtttatcaga ggggggaact acacccagca tgggtgtcct tcaagtagtg aagcagagtg ttcagatccc agtttttgtg atgattcggc cacggggagg tgattttttg tattcagatc gtgaaattga ggtgatgaag gctgacattc gtcttgccaa gctttatggt gctgatggtt tggtttttgg ggcattgact gaagatggac acattgacaa agagctgtgt atgtccctta tggctatttg ccgccctctg ccagtcactt tccaccgagc ctttgacatg gttcatgatc caatggcagc tctggagacc ctcttaacct tgggatttga acgcgtgttg accagtggat gtgacagttc agcattagaa gggctacccc taataaagcg actcattgag caggcaaaag gcaggattgt ggtaatgcca ggaggtggta taacagacag aaatctacaa aggatccttg agggttcagg tgctacagaa ttccactgtt ctgctcggtc tactagagac tcgggaatga agtttcgaaa ttcatctgtt gccatgggag cctcactttc ttgctcagaa tattccctaa aggtaacaga tgtgaccaaa gtaaggactt tgaatgctat cgcaaagaac atcctggtgt ag. It is sometimes possible for the material contained within the vial of "CUTC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.