Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CRLF3 cdna clone

CRLF3 cDNA Clone

Gene Names
CRLF3; FRWS; CRLM9; p48.2; CREME9; CYTOR4; CREME-9
Synonyms
CRLF3; CRLF3 cDNA Clone; CRLF3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggggggcgatggagctggagcctgagctgctgttgcaggaggcccgcgagaacgtggaggcagcgcagagctaccggcgggagctgggtcaccggcttgaggggctgcgtgaggcgcggaggcagatcaaagaaagtgcatcacagacaagggatgttctcaaacagcattttaatgatttaaagggaacccttggaaagctcctggatgagcgattggtgacccttttgcaagaggtggacaccattgaacaggagaccattaaaccactagatgactgccagaagctcatagaacacggagtcaacactgcagaggacttagtccgagaaggtgaaatcgccatgcttggtggtgtgggagaagagaatgagaaactgtggagctttaccaaaaaggcctcgcacattcagttggacagcttaccagaagtacctttactggttgatgtgccttgtttatctgctcagttggatgactcaattcttaacatagtgaaagaccacatttttaagcatggaacagtagcatctcgcccaccagtacagatagaagaactaatagagaaacctggaggcatcattgtacgatggtgtaaggtggatgatgactttacagcccaagattacaggctccagtttcgtaaatgtacttcaaatcattttgaggatgtatatgtaggttctgaaactgaattcatagtattgcacatagaccccaacgttgattaccagttcagagtctgcgcccgaggagatggccgacaggagtggagtccttggagtgtcccccagataggtcattccacattggtgcctcatgagtggacagctggttttgaggggtacagtctgagcagtcgaagaaatatagcacttcggaacgattctgaatcatcgggtgttctctactccagagctccgacttatttctgtgggcagacattaacattcagagttgaaactgtgggacagccagacagaagagatagcataggagtgtgtgcagaaaaacaggatggatatgactctctgcagcgggatcaagctgtgtgcattagtacaaatggtgcagtttttgtcaatggaaaagaaatgacaaatcagttacccgcagttacttctgggtccactgtcacgtttgacattgaagccgtgactctaggaaccaccagtaataatgaaggtggacacttcaagcttcgagtaactataagttcaaataatagagaagtggtttttgactggttacttgatcagtcttgtggttctctttactttggatgctcatttttctatcctggatggaaagtgttagtgttttag
Sequence Length
1329
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,350 Da
NCBI Official Full Name
Homo sapiens cytokine receptor-like factor 3, mRNA
NCBI Official Synonym Full Names
cytokine receptor like factor 3
NCBI Official Symbol
CRLF3
NCBI Official Synonym Symbols
FRWS; CRLM9; p48.2; CREME9; CYTOR4; CREME-9
NCBI Protein Information
cytokine receptor-like factor 3
UniProt Protein Name
Cytokine receptor-like factor 3
UniProt Gene Name
CRLF3
UniProt Synonym Gene Names
CREME9; CRLM9; CYTOR4; P48; CREME-9
UniProt Entry Name
CRLF3_HUMAN

NCBI Description

This gene encodes a cytokine receptor-like factor that may negatively regulate cell cycle progression at the G0/G1 phase. Studies of the related rat protein suggest that it may regulate neuronal morphology and synaptic vesicle biogenesis. This gene is one of several genes located in the neurofibromatosis type I tumor suppressor region on the q arm of chromosome 17, a region that is subject to microdeletions, duplications, chromosomal breaks and rearrangements. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2 and 5. [provided by RefSeq, Aug 2012]

Uniprot Description

CRLF3: a cytokine receptor-like factor that may negatively regulate cell cycle progression at the G0/G1 phase. Studies of the related rat protein suggest that it may regulate neuronal morphology and synaptic vesicle biogenesis. This gene is one of several genes located in the neurofibromatosis type I tumor suppressor region on the q arm of chromosome 17, a region that is subject to microdeletions, duplications, chromosomal breaks and rearrangements. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 2 and 5. [provided by RefSeq, Aug 2012]

Chromosomal Location of Human Ortholog: 17q11.2

Cellular Component: cytoplasm; plasma membrane

Molecular Function: protein binding

Biological Process: G1/S transition of mitotic cell cycle; negative regulation of cell growth; positive regulation of JAK-STAT cascade; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent

Research Articles on CRLF3

Similar Products

Product Notes

The CRLF3 crlf3 (Catalog #AAA1268304) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagggggg cgatggagct ggagcctgag ctgctgttgc aggaggcccg cgagaacgtg gaggcagcgc agagctaccg gcgggagctg ggtcaccggc ttgaggggct gcgtgaggcg cggaggcaga tcaaagaaag tgcatcacag acaagggatg ttctcaaaca gcattttaat gatttaaagg gaacccttgg aaagctcctg gatgagcgat tggtgaccct tttgcaagag gtggacacca ttgaacagga gaccattaaa ccactagatg actgccagaa gctcatagaa cacggagtca acactgcaga ggacttagtc cgagaaggtg aaatcgccat gcttggtggt gtgggagaag agaatgagaa actgtggagc tttaccaaaa aggcctcgca cattcagttg gacagcttac cagaagtacc tttactggtt gatgtgcctt gtttatctgc tcagttggat gactcaattc ttaacatagt gaaagaccac atttttaagc atggaacagt agcatctcgc ccaccagtac agatagaaga actaatagag aaacctggag gcatcattgt acgatggtgt aaggtggatg atgactttac agcccaagat tacaggctcc agtttcgtaa atgtacttca aatcattttg aggatgtata tgtaggttct gaaactgaat tcatagtatt gcacatagac cccaacgttg attaccagtt cagagtctgc gcccgaggag atggccgaca ggagtggagt ccttggagtg tcccccagat aggtcattcc acattggtgc ctcatgagtg gacagctggt tttgaggggt acagtctgag cagtcgaaga aatatagcac ttcggaacga ttctgaatca tcgggtgttc tctactccag agctccgact tatttctgtg ggcagacatt aacattcaga gttgaaactg tgggacagcc agacagaaga gatagcatag gagtgtgtgc agaaaaacag gatggatatg actctctgca gcgggatcaa gctgtgtgca ttagtacaaa tggtgcagtt tttgtcaatg gaaaagaaat gacaaatcag ttacccgcag ttacttctgg gtccactgtc acgtttgaca ttgaagccgt gactctagga accaccagta ataatgaagg tggacacttc aagcttcgag taactataag ttcaaataat agagaagtgg tttttgactg gttacttgat cagtcttgtg gttctcttta ctttggatgc tcatttttct atcctggatg gaaagtgtta gtgttttag. It is sometimes possible for the material contained within the vial of "CRLF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.