CRISP3 cdna clone
CRISP3 cDNA Clone
Gene Names
CRISP3; Aeg2; CRS3; SGP28; CRISP-3; dJ442L6.3
Synonyms
CRISP3; CRISP3 cDNA Clone; CRISP3 cdna clone
Sequence
atgacattattcccagtgctgttgttcctggttgctgggctgcttccatcttttccagcaaatgaagataaggatcccgcttttactgctttgttaaccacccaaacacaagtgcaaagggagattgtgaataagcacaatgaactgaggagagcagtatctccccctgccagaaacatgctgaagatggaatggaacaaagaggctgcagcaaatgcccaaaagtgggcaaaccagtgcaattacagacacagtaacccaaaggatcgaatgacaagtctaaaatgtggtgagaatctctacatgtcaagtgcctccagctcatggtcacaagcaatccaaagctggtttgatgagtacaatgattttgactttggtgtagggccaaagactcccaacgcagtggttggacattatacacaggttgtttggtactcttcatacctcgttggatgtggaaatgcctactgtcccaatcaaaaagttctaaaatactactatgtttgccaatattgtcctgctggtaattgggctaatagactatatgtcccttatgaacaaggagcaccttgtgccagttgcccagataactgtgacgatggactatgcaccaatggttgcaagtacgaagatctctatagtaactgtaaaagtttgaagctcacattaacctgtaaacatcagttggtcagggacagttgcaaggcctcctgcaattgttcaaacagcatttattaa
Sequence Length
738
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
30,116 Da
NCBI Official Full Name
Homo sapiens cysteine-rich secretory protein 3, mRNA
NCBI Official Synonym Full Names
cysteine rich secretory protein 3
NCBI Official Symbol
CRISP3
NCBI Official Synonym Symbols
Aeg2; CRS3; SGP28; CRISP-3; dJ442L6.3
NCBI Protein Information
cysteine-rich secretory protein 3
UniProt Protein Name
Cysteine-rich secretory protein 3
Protein Family
UniProt Gene Name
CRISP3
UniProt Synonym Gene Names
CRISP-3; SGP28
UniProt Entry Name
CRIS3_HUMAN
Uniprot Description
CRISP3: Belongs to the CRISP family. 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted, signal peptide; Secreted
Chromosomal Location of Human Ortholog: 6p12.3
Cellular Component: extracellular region; extracellular space; specific granule
Research Articles on CRISP3
Similar Products
Product Notes
The CRISP3 crisp3 (Catalog #AAA1271574) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacattat tcccagtgct gttgttcctg gttgctgggc tgcttccatc ttttccagca aatgaagata aggatcccgc ttttactgct ttgttaacca cccaaacaca agtgcaaagg gagattgtga ataagcacaa tgaactgagg agagcagtat ctccccctgc cagaaacatg ctgaagatgg aatggaacaa agaggctgca gcaaatgccc aaaagtgggc aaaccagtgc aattacagac acagtaaccc aaaggatcga atgacaagtc taaaatgtgg tgagaatctc tacatgtcaa gtgcctccag ctcatggtca caagcaatcc aaagctggtt tgatgagtac aatgattttg actttggtgt agggccaaag actcccaacg cagtggttgg acattataca caggttgttt ggtactcttc atacctcgtt ggatgtggaa atgcctactg tcccaatcaa aaagttctaa aatactacta tgtttgccaa tattgtcctg ctggtaattg ggctaataga ctatatgtcc cttatgaaca aggagcacct tgtgccagtt gcccagataa ctgtgacgat ggactatgca ccaatggttg caagtacgaa gatctctata gtaactgtaa aagtttgaag ctcacattaa cctgtaaaca tcagttggtc agggacagtt gcaaggcctc ctgcaattgt tcaaacagca tttattaa. It is sometimes possible for the material contained within the vial of "CRISP3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
