Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CREB1 cdna clone

CREB1 cDNA Clone

Gene Names
CREB1; CREB; CREB-1
Synonyms
CREB1; CREB1 cDNA Clone; CREB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaccatggaatctggagccgagaaccagcagagtggagatgcagctgtaacagaagctgaaaaccaacaaatgacagttcaagcccagccacagattgccacattagcccaggtatctatgccagcagctcatgcaacatcatctgctcccaccgtaactctagtacagctgcccaatgggcagacagttcaagtccatggagtcattcaggcggcccagccatcagttattcagtctccacaagtccaaacagttcagtcttcctgtaaggacttaaaaagacttttctccggaacacagatttcaactattgcagaaagtgaagattcacaggagtcagtggatagtgtaactgattcccaaaagcgaagggaaattctttcaaggaggccttcctacaggaaaattttgaatgacttatcttctgatgcaccaggagtgccaaggattgaagaagagaagtctgaagaggagacttcagcacctgccatcaccactgtaacggtgccaactccaatttaccaaactagcagtggacagtatattgccattacccagggaggagcaatacagctggctaacaatggtaccgatggggtacagggcctgcaaacattaaccatgaccaatgcagcagccactcagccgggtactaccattctacagtatgcacagaccactgatggacagcagatcttagtgcccagcaaccaagttgttgttcaagctgcctctggagacgtacaaacataccagattcgcacagcacccactagcactattgcccctggagttgttatggcatcctccccagcacttcctacacagcctgctgaagaagcagcacgaaagagagaggtccgtctaatgaagaacagggaagcagctcgagagtgtcgtagaaagaagaaagaatatgtgaaatgtttagaaaacagagtggcagtgcttgaaaatcaaaacaagacattgattgaggagctaaaagcacttaaggacctttactgccacaaatcagattaa
Sequence Length
1026
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,445 Da
NCBI Official Full Name
Homo sapiens cAMP responsive element binding protein 1, mRNA
NCBI Official Synonym Full Names
cAMP responsive element binding protein 1
NCBI Official Symbol
CREB1
NCBI Official Synonym Symbols
CREB; CREB-1
NCBI Protein Information
cyclic AMP-responsive element-binding protein 1
UniProt Protein Name
Cyclic AMP-responsive element-binding protein 1
UniProt Gene Name
CREB1
UniProt Synonym Gene Names
CREB-1; cAMP-responsive element-binding protein 1
UniProt Entry Name
CREB1_HUMAN

NCBI Description

This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. This protein binds as a homodimer to the cAMP-responsive element, an octameric palindrome. The protein is phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Alternate splicing of this gene results in several transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]

Uniprot Description

CREB: a transcription factor of the leucine zipper family of DNA binding proteins. Binds as a homodimer to the cAMP-responsive element (CRE). Phosphorylated by several protein kinases, and induces transcription of genes in response to hormonal stimulation of the cAMP pathway. Two splice-variant isoforms have been described.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 2q34

Cellular Component: nucleoplasm; nucleus

Molecular Function: enzyme binding; identical protein binding; protein binding; RNA polymerase II transcription factor activity, enhancer binding; transcription cofactor activity; transcription factor activity

Biological Process: axon guidance; circadian rhythm; positive regulation of fat cell differentiation; positive regulation of lipid biosynthetic process; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; protein amino acid phosphorylation; protein stabilization; response to glucagon stimulus; response to organic substance; signal transduction

Disease: Histiocytoma, Angiomatoid Fibrous

Research Articles on CREB1

Similar Products

Product Notes

The CREB1 creb1 (Catalog #AAA1276069) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaccatgg aatctggagc cgagaaccag cagagtggag atgcagctgt aacagaagct gaaaaccaac aaatgacagt tcaagcccag ccacagattg ccacattagc ccaggtatct atgccagcag ctcatgcaac atcatctgct cccaccgtaa ctctagtaca gctgcccaat gggcagacag ttcaagtcca tggagtcatt caggcggccc agccatcagt tattcagtct ccacaagtcc aaacagttca gtcttcctgt aaggacttaa aaagactttt ctccggaaca cagatttcaa ctattgcaga aagtgaagat tcacaggagt cagtggatag tgtaactgat tcccaaaagc gaagggaaat tctttcaagg aggccttcct acaggaaaat tttgaatgac ttatcttctg atgcaccagg agtgccaagg attgaagaag agaagtctga agaggagact tcagcacctg ccatcaccac tgtaacggtg ccaactccaa tttaccaaac tagcagtgga cagtatattg ccattaccca gggaggagca atacagctgg ctaacaatgg taccgatggg gtacagggcc tgcaaacatt aaccatgacc aatgcagcag ccactcagcc gggtactacc attctacagt atgcacagac cactgatgga cagcagatct tagtgcccag caaccaagtt gttgttcaag ctgcctctgg agacgtacaa acataccaga ttcgcacagc acccactagc actattgccc ctggagttgt tatggcatcc tccccagcac ttcctacaca gcctgctgaa gaagcagcac gaaagagaga ggtccgtcta atgaagaaca gggaagcagc tcgagagtgt cgtagaaaga agaaagaata tgtgaaatgt ttagaaaaca gagtggcagt gcttgaaaat caaaacaaga cattgattga ggagctaaaa gcacttaagg acctttactg ccacaaatca gattaa. It is sometimes possible for the material contained within the vial of "CREB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.