Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CPSF3 cdna clone

CPSF3 cDNA Clone

Gene Names
CPSF3; CPSF73; CPSF-73
Synonyms
CPSF3; CPSF3 cDNA Clone; CPSF3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgcgattcctgctgaggagagcgaccagctgctgatccgaccccttggagctgggcaagaagtaggaagatcatgtattattctcgagttcaaaggaagaaaaataatgctcgactgtgggatccaccctggcctagaaggaatggatgctcttccttatattgatttaattgacccagctgagattgatctcctattaattagtcatttccatttggatcactgtggagctctgccctggtttctacagaagacaagtttcaaaggaagaacatttatgactcatgccacaaaagctatttatagatggcttctttctgattatgtcaaagttagtaacatatcagcagacgacatgctgtataccgagacagatttggaagaaagcatggacaaaattgaaactatcaactttcatggagttaaggaagttgcgggaatcaagttttggtgttaccatgcaggtcacgtcctaggagccgccatgttcatgattgagatcgcaggcgtgaagcttttgtacactggtgatttctcaagacaagaagataggcacttaatggcagctgaaattcctaatattaagcctgatattcttatcattgaatctacttatgggacccatatccatgagaaacgtgaagagcgagaagcaagattctgtaacactgtccacgatattgtaaacagaggaggcaggggtctcattcctgtctttgctcttggaagggctcaggagctgctcttgattctagatgagtactggcagaatcacccagaactacatgacattccaatatactatgcatcatctttggccaagaagtgtatggcagtgtaccagacatatgtaaatgccatgaatgacaaaatccgcaaacagatcaacatcaataatccctttgttttcaaacacattagtaacctcaagagcatggatcattttgatgacattggtcccagtgttgtaatggcctccccaggcatgatgcaaagtggcttatccagagaattatttgaaagctggtgtactgataagaggaatggtgtcattatagcgggatactgtgtagaagggacacttgccaagcacatcatgtctgaacctgaagaaatcactactatgtctggacagaagttaccactgaaaatgtctgttgattacatttctttctcagctcacacggattaccagcaaaccagtgaatttattcgtgctttgaaaccgcctcatgtgattttagtccatggagaacagaatgaaatggccagattgaaagcagcactgattcgagaatatgaagataacgatgaagttcacatagaggttcataatcctcggaatacagaagcagtgaccttaaacttcagaggagaaaaactagccaaggttatgggatttttagcagacaaaaaaccagaacaaggccagcgggtctcaggaatacttgttaaaagaaactttaattatcacatactttctccttgcgacctgtccaattatactgacctggccatgagcacggtgaagcagacccaagccattccatatactggtccctttaatttgctctgttaccagctgcagaaattgacaggtgatgtggaagaattagaaattcaagaaaaacctgctctgaaagtgttcaaaaatattactgtaatacaagaaccaggcatggtggtattagaatggctggcaaacccttctaatgatatgtatgcagatacagtaacaactgtgatattggaagttcagtcaaatcccaaaataagaaaaggtgcagtacagaaggtttctaaaaaattagaaatgcacgtttacagcaagaggttggagatcatgctccaggacatatttggagaagactgtgtaagtgtaaaggatgactctattcttagcgtcacagtggacgggaaaactgccaaccttaacttggagacacggactgtagaatgtgaagagggaagtgaagacgatgaatccctccgagaaatggtggagctggctgcacagagactgtacgaggccctgacgccagttcactga
Sequence Length
2055
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
77,486 Da
NCBI Official Full Name
Homo sapiens cleavage and polyadenylation specific factor 3, 73kDa, mRNA
NCBI Official Synonym Full Names
cleavage and polyadenylation specific factor 3
NCBI Official Symbol
CPSF3
NCBI Official Synonym Symbols
CPSF73; CPSF-73
NCBI Protein Information
cleavage and polyadenylation specificity factor subunit 3
UniProt Protein Name
Cleavage and polyadenylation specificity factor subunit 3
UniProt Gene Name
CPSF3
UniProt Synonym Gene Names
CPSF73; CPSF 73 kDa subunit
UniProt Entry Name
CPSF3_HUMAN

NCBI Description

This gene encodes a member of the metallo-beta-lactamase family. The encoded protein is a 73kDa subunit of the cleavage and polyadenylation specificity factor and functions as an endonuclease that recognizes the pre-mRNA 3'-cleavage site AAUAAA prior to polyadenylation. It also cleaves after the pre-mRNA sequence ACCCA during histone 3'-end pre-mRNA processing. [provided by RefSeq, Oct 2012]

Uniprot Description

CPSF3: Component of the cleavage and polyadenylation specificity factor (CPSF) complex that play a key role in pre-mRNA 3'-end formation, recognizing the AAUAAA signal sequence and interacting with poly(A) polymerase and other factors to bring about cleavage and poly(A) addition. Has endonuclease activity, and functions as mRNA 3'-end-processing endonuclease. Also involved in the histone 3'-end pre-mRNA processing. U7 snRNP- dependent protein that induces both the 3'-endoribonucleolytic cleavage of histone pre-mRNAs and acts as a 5' to 3' exonuclease for degrading the subsequent downstream cleavage product (DCP) of mature histone mRNAs. Cleavage occurs after the 5'-ACCCA-3' sequence in the histone pre-mRNA leaving a 3'hydroxyl group on the upstream fragment containing the stem loop (SL) and 5' phosphate on the downstream cleavage product (DCP) starting with CU nucleotides. The U7-dependent 5' to 3' exonuclease activity is processive and degrades the DCP RNA substrate even after complete removal of the U7-binding site. Binds to the downstream cleavage product (DCP) of histone pre-mRNAs and the cleaved DCP RNA substrate in a U7 snRNP dependent manner. Belongs to the metallo-beta-lactamase superfamily. RNA-metabolizing metallo-beta-lactamase-like family. CPSF3 subfamily.

Protein type: RNA splicing; RNA processing; EC 3.1.27.-; Ribonuclease; RNA-binding

Chromosomal Location of Human Ortholog: 2p25.1

Cellular Component: mRNA cleavage and polyadenylation specificity factor complex; nucleoplasm

Molecular Function: 5'-3' exonuclease activity; endoribonuclease activity; protein binding; RNA binding

Biological Process: histone mRNA 3'-end processing; mRNA 3'-end processing; mRNA cleavage; mRNA export from nucleus; mRNA polyadenylation; nuclear mRNA splicing, via spliceosome; termination of RNA polymerase II transcription

Research Articles on CPSF3

Similar Products

Product Notes

The CPSF3 cpsf3 (Catalog #AAA1274276) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgcga ttcctgctga ggagagcgac cagctgctga tccgacccct tggagctggg caagaagtag gaagatcatg tattattctc gagttcaaag gaagaaaaat aatgctcgac tgtgggatcc accctggcct agaaggaatg gatgctcttc cttatattga tttaattgac ccagctgaga ttgatctcct attaattagt catttccatt tggatcactg tggagctctg ccctggtttc tacagaagac aagtttcaaa ggaagaacat ttatgactca tgccacaaaa gctatttata gatggcttct ttctgattat gtcaaagtta gtaacatatc agcagacgac atgctgtata ccgagacaga tttggaagaa agcatggaca aaattgaaac tatcaacttt catggagtta aggaagttgc gggaatcaag ttttggtgtt accatgcagg tcacgtccta ggagccgcca tgttcatgat tgagatcgca ggcgtgaagc ttttgtacac tggtgatttc tcaagacaag aagataggca cttaatggca gctgaaattc ctaatattaa gcctgatatt cttatcattg aatctactta tgggacccat atccatgaga aacgtgaaga gcgagaagca agattctgta acactgtcca cgatattgta aacagaggag gcaggggtct cattcctgtc tttgctcttg gaagggctca ggagctgctc ttgattctag atgagtactg gcagaatcac ccagaactac atgacattcc aatatactat gcatcatctt tggccaagaa gtgtatggca gtgtaccaga catatgtaaa tgccatgaat gacaaaatcc gcaaacagat caacatcaat aatccctttg ttttcaaaca cattagtaac ctcaagagca tggatcattt tgatgacatt ggtcccagtg ttgtaatggc ctccccaggc atgatgcaaa gtggcttatc cagagaatta tttgaaagct ggtgtactga taagaggaat ggtgtcatta tagcgggata ctgtgtagaa gggacacttg ccaagcacat catgtctgaa cctgaagaaa tcactactat gtctggacag aagttaccac tgaaaatgtc tgttgattac atttctttct cagctcacac ggattaccag caaaccagtg aatttattcg tgctttgaaa ccgcctcatg tgattttagt ccatggagaa cagaatgaaa tggccagatt gaaagcagca ctgattcgag aatatgaaga taacgatgaa gttcacatag aggttcataa tcctcggaat acagaagcag tgaccttaaa cttcagagga gaaaaactag ccaaggttat gggattttta gcagacaaaa aaccagaaca aggccagcgg gtctcaggaa tacttgttaa aagaaacttt aattatcaca tactttctcc ttgcgacctg tccaattata ctgacctggc catgagcacg gtgaagcaga cccaagccat tccatatact ggtcccttta atttgctctg ttaccagctg cagaaattga caggtgatgt ggaagaatta gaaattcaag aaaaacctgc tctgaaagtg ttcaaaaata ttactgtaat acaagaacca ggcatggtgg tattagaatg gctggcaaac ccttctaatg atatgtatgc agatacagta acaactgtga tattggaagt tcagtcaaat cccaaaataa gaaaaggtgc agtacagaag gtttctaaaa aattagaaat gcacgtttac agcaagaggt tggagatcat gctccaggac atatttggag aagactgtgt aagtgtaaag gatgactcta ttcttagcgt cacagtggac gggaaaactg ccaaccttaa cttggagaca cggactgtag aatgtgaaga gggaagtgaa gacgatgaat ccctccgaga aatggtggag ctggctgcac agagactgta cgaggccctg acgccagttc actga. It is sometimes possible for the material contained within the vial of "CPSF3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.