Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CPA1 cdna clone

CPA1 cDNA Clone

Gene Names
CPA1; CPA
Synonyms
CPA1; CPA1 cDNA Clone; CPA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcgggggttgctggtgttgagtgtcctgttgggggctgtctttggcaaggaggactttgtggggcatcaggtgctccgaatctctgtagccgatgaggcccaggtacagaaggtgaaggagctggaggacctggagcacctgcagctggacttctggcggggccctgcccaccctggctcccccatcgacgtccgagtgcccttccccagcatccaggcggtcaagatctttctggagtcccacggcatcagctatgagaccatgatcgaggacgtgcagtcgctgctggacgaggagcaggagcagatgttcgccttccggtcccgggcgcgctccaccgacacttttaactacgccacctaccacaccctggaggagatctatgacttcctggacctgctggtggcggagaacccgcaccttgtcagcaagatccagattggcaacacctatgaagggcgtcccatttacgtgctgaagttcagcacggggggcagtaagcgtccagccatctggatcgacacgggcatccattcccgggagtgggtcacccaggccagtggggtctggtttgcaaagaagatcactcaagactacgggcaggatgcagctttcaccgccattctcgacaccttggacatcttcctggagatcgtcaccaaccctgatggctttgccttcacgcacagcacgaatcgcatgtggcgcaagactcggtcccacacagcaggctccctctgtattggcgtggaccccaacaggaactgggacgctggctttgggttgtccggagccagcagtaacccctgctcggagacttaccgcggcaagtttgccaattccgaagtggaggtcaagtccattgtagactttgtgaaggaccatgggaacatcaaggccttcatctccatccacagctactcccagctcctcatgtatccctatggctacaaaacagaaccagtccctgaccaggatgagctggatcagctttccaaggctgctgtgacagccctggcctctctctacgggaccaagttcaactatggcagcatcatcaaggcaatttatcaagccagtggaagcactattgactggacctacagccagggcatcaagtactccttcaccttcgagctccgggacactgggcgctatggcttcctgctgccagcctcccagatcatccccacagccaaggagacgtggctggcgcttctgaccatcatggagcacaccctgaatcacccctactga
Sequence Length
1260
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,140 Da
NCBI Official Full Name
Homo sapiens carboxypeptidase A1 (pancreatic), mRNA
NCBI Official Synonym Full Names
carboxypeptidase A1
NCBI Official Symbol
CPA1
NCBI Official Synonym Symbols
CPA
NCBI Protein Information
carboxypeptidase A1
UniProt Protein Name
Carboxypeptidase A1
Protein Family
UniProt Gene Name
CPA1
UniProt Synonym Gene Names
CPA
UniProt Entry Name
CBPA1_HUMAN

NCBI Description

This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases. This enzyme is produced in the pancreas and preferentially cleaves C-terminal branched-chain and aromatic amino acids from dietary proteins. This gene and several family members are present in a gene cluster on chromosome 7. Mutations in this gene may be linked to chronic pancreatitis, while elevated protein levels may be associated with pancreatic cancer. [provided by RefSeq, Jan 2015]

Uniprot Description

CPA1: Carboxypeptidase that catalyzes the release of a C- terminal amino acid, but has little or no action with -Asp, -Glu, -Arg, -Lys or -Pro. Belongs to the peptidase M14 family.

Protein type: Protease; EC 3.4.17.1; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 7q32

Cellular Component: extracellular space

Research Articles on CPA1

Similar Products

Product Notes

The CPA1 cpa1 (Catalog #AAA1278978) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgggggt tgctggtgtt gagtgtcctg ttgggggctg tctttggcaa ggaggacttt gtggggcatc aggtgctccg aatctctgta gccgatgagg cccaggtaca gaaggtgaag gagctggagg acctggagca cctgcagctg gacttctggc ggggccctgc ccaccctggc tcccccatcg acgtccgagt gcccttcccc agcatccagg cggtcaagat ctttctggag tcccacggca tcagctatga gaccatgatc gaggacgtgc agtcgctgct ggacgaggag caggagcaga tgttcgcctt ccggtcccgg gcgcgctcca ccgacacttt taactacgcc acctaccaca ccctggagga gatctatgac ttcctggacc tgctggtggc ggagaacccg caccttgtca gcaagatcca gattggcaac acctatgaag ggcgtcccat ttacgtgctg aagttcagca cggggggcag taagcgtcca gccatctgga tcgacacggg catccattcc cgggagtggg tcacccaggc cagtggggtc tggtttgcaa agaagatcac tcaagactac gggcaggatg cagctttcac cgccattctc gacaccttgg acatcttcct ggagatcgtc accaaccctg atggctttgc cttcacgcac agcacgaatc gcatgtggcg caagactcgg tcccacacag caggctccct ctgtattggc gtggacccca acaggaactg ggacgctggc tttgggttgt ccggagccag cagtaacccc tgctcggaga cttaccgcgg caagtttgcc aattccgaag tggaggtcaa gtccattgta gactttgtga aggaccatgg gaacatcaag gccttcatct ccatccacag ctactcccag ctcctcatgt atccctatgg ctacaaaaca gaaccagtcc ctgaccagga tgagctggat cagctttcca aggctgctgt gacagccctg gcctctctct acgggaccaa gttcaactat ggcagcatca tcaaggcaat ttatcaagcc agtggaagca ctattgactg gacctacagc cagggcatca agtactcctt caccttcgag ctccgggaca ctgggcgcta tggcttcctg ctgccagcct cccagatcat ccccacagcc aaggagacgt ggctggcgct tctgaccatc atggagcaca ccctgaatca cccctactga. It is sometimes possible for the material contained within the vial of "CPA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.