Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COX7A2 cdna clone

COX7A2 cDNA Clone

Gene Names
COX7A2; VIIAL; COX7AL; COX7AL1; COXVIIAL; COXVIIa-L
Synonyms
COX7A2; COX7A2 cDNA Clone; COX7A2 cdna clone
Ordering
For Research Use Only!
Sequence
ATGCTGTGGAATCTGCTGGCTCTTCGTCAGATTGGGCAGAGGACGATAAGCACTGCTTCCCGCAGGCATTTTAAAAATAAAGTTCCGGAGAAGCAAAAACTGTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGGGTAGCTGATGCCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATGAGCTGGCTGTGGCTTCATTTCCCAAGAAGCAGGAGTGA
Sequence Length
252
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
9,396 Da
NCBI Official Full Name
Homo sapiens cytochrome c oxidase subunit VIIa polypeptide 2 (liver), mRNA
NCBI Official Synonym Full Names
cytochrome c oxidase subunit 7A2
NCBI Official Symbol
COX7A2
NCBI Official Synonym Symbols
VIIAL; COX7AL; COX7AL1; COXVIIAL; COXVIIa-L
NCBI Protein Information
cytochrome c oxidase subunit 7A2, mitochondrial
UniProt Protein Name
Cytochrome c oxidase subunit 7A2, mitochondrial
Protein Family
UniProt Gene Name
COX7A2
UniProt Synonym Gene Names
COX7AL; Cytochrome c oxidase subunit VIIa-L; Cytochrome c oxidase subunit VIIaL
UniProt Entry Name
CX7A2_HUMAN

NCBI Description

Cytochrome c oxidase, the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of three catalytic subunits encoded by mitochondrial genes, and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, while the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 2 (liver isoform) of subunit VIIa, with this polypeptide being present in both muscle and non-muscle tissues. In addition to polypeptide 2, subunit VIIa includes polypeptide 1 (muscle isoform), which is present only in muscle tissues, and a related protein, which is present in all tissues. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4 and 14. [provided by RefSeq, Oct 2009]

Uniprot Description

COX7A2: This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. Belongs to the cytochrome c oxidase VIIa family.

Protein type: EC 1.9.3.1; Mitochondrial; Oxidoreductase; Energy Metabolism - oxidative phosphorylation

Chromosomal Location of Human Ortholog: 6q12

Research Articles on COX7A2

Similar Products

Product Notes

The COX7A2 cox7a2 (Catalog #AAA1270250) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCTGTGGA ATCTGCTGGC TCTTCGTCAG ATTGGGCAGA GGACGATAAG CACTGCTTCC CGCAGGCATT TTAAAAATAA AGTTCCGGAG AAGCAAAAAC TGTTCCAGGA GGATGATGAA ATTCCACTGT ATCTAAAGGG TGGGGTAGCT GATGCCCTCC TGTATAGAGC CACCATGATT CTTACAGTTG GTGGAACAGC ATATGCCATA TATGAGCTGG CTGTGGCTTC ATTTCCCAAG AAGCAGGAGT GA. It is sometimes possible for the material contained within the vial of "COX7A2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.