Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COQ3 cdna clone

COQ3 cDNA Clone

Gene Names
COQ3; DHHBMT; bA9819.1; DHHBMTASE; UG0215E05
Synonyms
COQ3; COQ3 cDNA Clone; COQ3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggagtggccgtaagctgggctcctccgggggttggtttttaagagtgctggggcctggaggctgtaatacaaaagctgcgcgtcccttaatttcctcggcggtttatgtgaagaaccagctcagtgggactctacagattaaaccaggggttttcaatgaatacagaaccatatggttcaaatcctacaggacgatcttttcctgtttgaacagaataaagagtttcaggtacccttgggcgagactgtacagtacttcccaaaccactgtcgacagcggtgaggtaaaaaccttcttggccctggctcacaaatggtgggatgaacaaggagtatatgcacctcttcattccatgaatgacctgagggtgccatttattagggacaatcttctgaaaacaattcctaatcaccagccaggaaaacctttgttggggatgaagattcttgacgttggctgtggtggtgggctgttaactgaacctctagggcggcttggggcttcagttattggaatcgaccctgtggatgagaacattaaaacagcacaatgccataaatcatttgatccagtcctggataagagaatagagtacagagtgtgttccctggaagagattgtggaagagactgcagaaacatttgatgctgttgtagcttctgaagttgtagaacatgtgattgatctagaaacatttttacagtgctgctgtcaagtgttaaaacccggtggttctttattcattactacaatcaacaaaacacaactttcctatgccttgggaattgttttttcagagcaaattgcaggtattgtaccaaaaggtactcatacatgggagaagtttgtttcacctgaaacactagagagcattctggaatcaaatggtctgtcagttcaaacagtggtaggaatgctctataaccccttctcaggttactggcattggagtgaaaataccagccttaactatgcagctcatgctgtgaaatccagggtccaggaacacccagcctctgctgagtttgttttaaagggagaaacagaagagctccaagctaatgcctgcaccaatccagctgtgcatgaaaagctgaagaaatga
Sequence Length
1110
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,054 Da
NCBI Official Full Name
Homo sapiens coenzyme Q3 homolog, methyltransferase (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
coenzyme Q3, methyltransferase
NCBI Official Symbol
COQ3
NCBI Official Synonym Symbols
DHHBMT; bA9819.1; DHHBMTASE; UG0215E05
NCBI Protein Information
ubiquinone biosynthesis O-methyltransferase, mitochondrial
UniProt Protein Name
Ubiquinone biosynthesis O-methyltransferase, mitochondrial
UniProt Gene Name
COQ3
UniProt Entry Name
COQ3_HUMAN

NCBI Description

Ubiquinone, also known as coenzyme Q, or Q, is a critical component of the electron transport pathways of both eukaryotes and prokaryotes (Jonassen and Clarke, 2000 [PubMed 10777520]). This lipid consists of a hydrophobic isoprenoid tail and a quinone head group. The tail varies in length depending on the organism, but its purpose is to anchor coenzyme Q to the membrane. The quinone head group is responsible for the activity of coenzyme Q in the respiratory chain. The S. cerevisiae COQ3 gene encodes an O-methyltransferase required for 2 steps in the biosynthetic pathway of coenzyme Q. This enzyme methylates an early coenzyme Q intermediate, 3,4-dihydroxy-5-polyprenylbenzoic acid, as well as the final intermediate in the pathway, converting demethyl-ubiquinone to coenzyme Q. The COQ3 gene product is also capable of methylating the distinct prokaryotic early intermediate 2-hydroxy-6-polyprenyl phenol.[supplied by OMIM, Mar 2008]

Uniprot Description

COQ3: Belongs to the methyltransferase superfamily. UbiG/COQ3 family

Protein type: Methyltransferase; EC 2.1.1.114; Cofactor and Vitamin Metabolism - ubiquinone and other terpenoid-quinone biosynthesis; EC 2.1.1.64; EC 2.1.1.222; Mitochondrial

Chromosomal Location of Human Ortholog: 6q16.2

Cellular Component: mitochondrial matrix; mitochondrion

Molecular Function: O-methyltransferase activity; S-adenosylmethionine-dependent methyltransferase activity

Biological Process: glycerol metabolic process; ubiquinone biosynthetic process

Research Articles on COQ3

Similar Products

Product Notes

The COQ3 coq3 (Catalog #AAA1278826) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggagtg gccgtaagct gggctcctcc gggggttggt ttttaagagt gctggggcct ggaggctgta atacaaaagc tgcgcgtccc ttaatttcct cggcggttta tgtgaagaac cagctcagtg ggactctaca gattaaacca ggggttttca atgaatacag aaccatatgg ttcaaatcct acaggacgat cttttcctgt ttgaacagaa taaagagttt caggtaccct tgggcgagac tgtacagtac ttcccaaacc actgtcgaca gcggtgaggt aaaaaccttc ttggccctgg ctcacaaatg gtgggatgaa caaggagtat atgcacctct tcattccatg aatgacctga gggtgccatt tattagggac aatcttctga aaacaattcc taatcaccag ccaggaaaac ctttgttggg gatgaagatt cttgacgttg gctgtggtgg tgggctgtta actgaacctc tagggcggct tggggcttca gttattggaa tcgaccctgt ggatgagaac attaaaacag cacaatgcca taaatcattt gatccagtcc tggataagag aatagagtac agagtgtgtt ccctggaaga gattgtggaa gagactgcag aaacatttga tgctgttgta gcttctgaag ttgtagaaca tgtgattgat ctagaaacat ttttacagtg ctgctgtcaa gtgttaaaac ccggtggttc tttattcatt actacaatca acaaaacaca actttcctat gccttgggaa ttgttttttc agagcaaatt gcaggtattg taccaaaagg tactcataca tgggagaagt ttgtttcacc tgaaacacta gagagcattc tggaatcaaa tggtctgtca gttcaaacag tggtaggaat gctctataac cccttctcag gttactggca ttggagtgaa aataccagcc ttaactatgc agctcatgct gtgaaatcca gggtccagga acacccagcc tctgctgagt ttgttttaaa gggagaaaca gaagagctcc aagctaatgc ctgcaccaat ccagctgtgc atgaaaagct gaagaaatga. It is sometimes possible for the material contained within the vial of "COQ3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.