Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COPS2 cdna clone

COPS2 cDNA Clone

Gene Names
COPS2; CSN2; SGN2; ALIEN; TRIP15
Synonyms
COPS2; COPS2 cDNA Clone; COPS2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgacatggaggatgatttcatgtgcgatgatgaggaggactacgacctggaatactctgaagatagtaactccgagccaaatgtggatttggaaaatcagtactataattccaaagcattaaaagaagatgacccaaaagcggcattaagcagtttccaaaaggttttggaacttgaaggtgaaaaaggagaatggggatttaaagcactgaaacaaatgattaagattaacttcaagttgacaaactttccagaaatgatgaatagatataagcagctattgacctatattcggagtgcagtcacaagaaattattctgaaaaatccattaattctattcttgattatatctctacttctaaacagatggatttactgcaggaattctatgaaacaacactggaagctttgaaagatgctaagaatgatagactgtggtttaagacaaacacaaagcttggaaaattatatttagaacgagaggaatatggaaagcttcaaaaaattttacgccagttacatcagtcgtgccagactgatgatggagaagatgatctgaaaaaaggtacacagttattagaaatatatgctttggaaattcaaatgtacacagcacagaaaaataacaaaaaacttaaagcactctatgaacagtcacttcacatcaagtctgccatccctcatccactgattatgggagttatcagagaatgtggtggtaaaatgcacttgagggaaggtgaatttgaaaaggcacacactgatttttttgaagccttcaagaattatgatgaatctggaagtccaagacgaaccacttgcttaaaatatttggtcttagcaaatatgcttatgaaatcgggaataaatccatttgactcacaggaggccaagccgtacaaaaatgatccagaaattttagcaatgacgaatttagtaagtgcctatcagaataatgacatcactgaatttgaaaagattctaaaaacaaatcacagcaacatcatggatgatcctttcataagagaacacattgaagagcttttgcgaaacatcagaacacaagtgcttataaaattaattaagccttacacaagaatacatattccttttatttctaaggagttaaacatagatgtagctgatgtggagagcttgctggtgcagtgcatattggataacactattcatggccgaattgatcaagtcaaccaactccttgaactggatcatcagaagaggggtggtgcacgatatactgcactagataaatggaccaaccaactaaattctctcaaccaggctgtagtcagtaaactggcttaa
Sequence Length
1332
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,405 Da
NCBI Official Full Name
Homo sapiens COP9 constitutive photomorphogenic homolog subunit 2 (Arabidopsis), mRNA
NCBI Official Synonym Full Names
COP9 signalosome subunit 2
NCBI Official Symbol
COPS2
NCBI Official Synonym Symbols
CSN2; SGN2; ALIEN; TRIP15
NCBI Protein Information
COP9 signalosome complex subunit 2
UniProt Protein Name
COP9 signalosome complex subunit 2
UniProt Gene Name
COPS2
UniProt Synonym Gene Names
CSN2; TRIP15; SGN2; Signalosome subunit 2; TR-interacting protein 15; TRIP-15
UniProt Entry Name
CSN2_HUMAN

Uniprot Description

COPS2: Essential component of the COP9 signalosome complex (CSN), a complex involved in various cellular and developmental processes. The CSN complex is an essential regulator of the ubiquitin (Ubl) conjugation pathway by mediating the deneddylation of the cullin subunits of SCF-type E3 ligase complexes, leading to decrease the Ubl ligase activity of SCF-type complexes such as SCF, CSA or DDB2. The complex is also involved in phosphorylation of p53/TP53, c-jun/JUN, IkappaBalpha/NFKBIA, ITPK1 and IRF8/ICSBP, possibly via its association with CK2 and PKD kinases. CSN- dependent phosphorylation of TP53 and JUN promotes and protects degradation by the Ubl system, respectively. Involved in early stage of neuronal differentiation via its interaction with NIF3L1. Belongs to the CSN2 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Nuclear receptor co-regulator; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 15q21.2

Cellular Component: cytoplasm; nucleoplasm; signalosome

Molecular Function: protein binding

Biological Process: cullin deneddylation; nucleotide-excision repair, DNA damage recognition; transcription from RNA polymerase II promoter; transcription-coupled nucleotide-excision repair

Research Articles on COPS2

Similar Products

Product Notes

The COPS2 cops2 (Catalog #AAA1274067) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgaca tggaggatga tttcatgtgc gatgatgagg aggactacga cctggaatac tctgaagata gtaactccga gccaaatgtg gatttggaaa atcagtacta taattccaaa gcattaaaag aagatgaccc aaaagcggca ttaagcagtt tccaaaaggt tttggaactt gaaggtgaaa aaggagaatg gggatttaaa gcactgaaac aaatgattaa gattaacttc aagttgacaa actttccaga aatgatgaat agatataagc agctattgac ctatattcgg agtgcagtca caagaaatta ttctgaaaaa tccattaatt ctattcttga ttatatctct acttctaaac agatggattt actgcaggaa ttctatgaaa caacactgga agctttgaaa gatgctaaga atgatagact gtggtttaag acaaacacaa agcttggaaa attatattta gaacgagagg aatatggaaa gcttcaaaaa attttacgcc agttacatca gtcgtgccag actgatgatg gagaagatga tctgaaaaaa ggtacacagt tattagaaat atatgctttg gaaattcaaa tgtacacagc acagaaaaat aacaaaaaac ttaaagcact ctatgaacag tcacttcaca tcaagtctgc catccctcat ccactgatta tgggagttat cagagaatgt ggtggtaaaa tgcacttgag ggaaggtgaa tttgaaaagg cacacactga tttttttgaa gccttcaaga attatgatga atctggaagt ccaagacgaa ccacttgctt aaaatatttg gtcttagcaa atatgcttat gaaatcggga ataaatccat ttgactcaca ggaggccaag ccgtacaaaa atgatccaga aattttagca atgacgaatt tagtaagtgc ctatcagaat aatgacatca ctgaatttga aaagattcta aaaacaaatc acagcaacat catggatgat cctttcataa gagaacacat tgaagagctt ttgcgaaaca tcagaacaca agtgcttata aaattaatta agccttacac aagaatacat attcctttta tttctaagga gttaaacata gatgtagctg atgtggagag cttgctggtg cagtgcatat tggataacac tattcatggc cgaattgatc aagtcaacca actccttgaa ctggatcatc agaagagggg tggtgcacga tatactgcac tagataaatg gaccaaccaa ctaaattctc tcaaccaggc tgtagtcagt aaactggctt aa. It is sometimes possible for the material contained within the vial of "COPS2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.