Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COG4 cdna clone

COG4 cDNA Clone

Gene Names
COG4; COD1; CDG2J
Synonyms
COG4; COG4 cDNA Clone; COG4 cdna clone
Ordering
For Research Use Only!
Sequence
atggtgctggggacagacatgagtgatcggagagctgcagtcatctttgcagatacacttactcttctgtttgaagggattgcccgcattgtggagacccaccagccaatagtggagacctattatgggccagggagactctataccctgatcaaatatctgcaggtggaatgtgacagacaggtggagaaggtggtagacaagttcatcaagcaaagggactaccaccagcagttccggcatgttcagaacaacctgatgagaaattctacaacagaaaaaatcgaaccaagagaactggaccccatcctgactgaggtcaccctgatgaatgcccgcagtgagctatacttacgcttcctcaagaagaggattagctctgattttgaggtgggagactccatggcctcagaggaagtaaagcaagagcaccagaagtgtctggacaaactcctcaataactgccttttgagctgtaccatgcaggagctaattggcttatatgttaccatggaggagtacttcatgagggagactgtcaataaggctgtggctctggacacctatgagaagggccagctgacatccagcatggtggatgatgtcttctacattgttaagaagtgcattgggcgggctctgtccagctccagcattgactgtctctgtgccatgatcaacctcgccaccacagagctggagtctgacttcagggatgttctgtgtaataagctgcggatgggctttcctgccaccaccttccaggacatccagcgcggggtgacaagtgccgtgaacatcatgcacagcagcctccagcaaggcaaatttgacacaaaaggcatcgagagtactgacgaggcgaagatgtccttcctggtgactctgaacaacgtggaagtctgcagtgaaaacatctccactctgaagaagacactggagagtgactgcaccaagctcttcagccagggcattggaggggagcaggcccaggccaagtttgacagctgcctttctgacttggccgccgtgtccaacaaattccgagacctcttgcaggaagggctgacggagctcaacagcacagccatcaagccacaggtgcagccttggatcaacagctttttctccgtctcccacaacatcgaggaggaagaattcaatgactatgagtccaacgacccttgggtacaacagttcatccttaacctggagcagcaaatggcagagttcaaggccagcctgtccccggtcatctacgacagcctaaccggcctcatgactagccttgttgccgtcgagttggagaaagtggtgctgaaatccacctttaaccggctgggtggtctgcagtttgacaaggagctgaggtcactcattgcctaccttaccacggtgaccacctggaccatccgagacaagtttgcccggctctcccagatggccaccatcctcaatctggagcgggtgaccgagatcctcgattactggggacccaattccggcccattgacgtggcgcctcacccctgctgaagtgcgccaggtgctggccctgcggatagacttccgcagtgaagatatcaagaggctgcgcctgtag
Sequence Length
1602
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
81,098 Da
NCBI Official Full Name
Homo sapiens component of oligomeric golgi complex 4, mRNA
NCBI Official Synonym Full Names
component of oligomeric golgi complex 4
NCBI Official Symbol
COG4
NCBI Official Synonym Symbols
COD1; CDG2J
NCBI Protein Information
conserved oligomeric Golgi complex subunit 4
UniProt Protein Name
Conserved oligomeric Golgi complex subunit 4
UniProt Gene Name
COG4
UniProt Synonym Gene Names
COG complex subunit 4
UniProt Entry Name
COG4_HUMAN

NCBI Description

The protein encoded by this gene is a component of an oligomeric protein complex involved in the structure and function of the Golgi apparatus. Defects in this gene may be a cause of congenital disorder of glycosylation type IIj. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Aug 2010]

Uniprot Description

COG4: Required for normal Golgi function. Plays a role in SNARE-pin assembly and Golgi-to-ER retrograde transport via its interaction with SCFD1. Defects in COG4 are the cause of congenital disorder of glycosylation type 2J (CDG2J). It is a multisystem disorder caused by a defect in glycoprotein biosynthesis and characterized by under-glycosylated serum glycoproteins. Congenital disorders of glycosylation result in a wide variety of clinical features, such as defects in the nervous system development, psychomotor retardation, dysmorphic features, hypotonia, coagulation disorders, and immunodeficiency. The broad spectrum of features reflects the critical role of N-glycoproteins during embryonic development, differentiation, and maintenance of cell functions. Belongs to the COG4 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Vesicle

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: Golgi membrane; Golgi transport complex; trans-Golgi network membrane

Molecular Function: protein binding

Biological Process: ER to Golgi vesicle-mediated transport; Golgi organization and biogenesis; Golgi vesicle prefusion complex stabilization; retrograde transport, vesicle recycling within Golgi; retrograde vesicle-mediated transport, Golgi to ER

Disease: Congenital Disorder Of Glycosylation, Type Iij

Research Articles on COG4

Similar Products

Product Notes

The COG4 cog4 (Catalog #AAA1271295) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgctgg ggacagacat gagtgatcgg agagctgcag tcatctttgc agatacactt actcttctgt ttgaagggat tgcccgcatt gtggagaccc accagccaat agtggagacc tattatgggc cagggagact ctataccctg atcaaatatc tgcaggtgga atgtgacaga caggtggaga aggtggtaga caagttcatc aagcaaaggg actaccacca gcagttccgg catgttcaga acaacctgat gagaaattct acaacagaaa aaatcgaacc aagagaactg gaccccatcc tgactgaggt caccctgatg aatgcccgca gtgagctata cttacgcttc ctcaagaaga ggattagctc tgattttgag gtgggagact ccatggcctc agaggaagta aagcaagagc accagaagtg tctggacaaa ctcctcaata actgcctttt gagctgtacc atgcaggagc taattggctt atatgttacc atggaggagt acttcatgag ggagactgtc aataaggctg tggctctgga cacctatgag aagggccagc tgacatccag catggtggat gatgtcttct acattgttaa gaagtgcatt gggcgggctc tgtccagctc cagcattgac tgtctctgtg ccatgatcaa cctcgccacc acagagctgg agtctgactt cagggatgtt ctgtgtaata agctgcggat gggctttcct gccaccacct tccaggacat ccagcgcggg gtgacaagtg ccgtgaacat catgcacagc agcctccagc aaggcaaatt tgacacaaaa ggcatcgaga gtactgacga ggcgaagatg tccttcctgg tgactctgaa caacgtggaa gtctgcagtg aaaacatctc cactctgaag aagacactgg agagtgactg caccaagctc ttcagccagg gcattggagg ggagcaggcc caggccaagt ttgacagctg cctttctgac ttggccgccg tgtccaacaa attccgagac ctcttgcagg aagggctgac ggagctcaac agcacagcca tcaagccaca ggtgcagcct tggatcaaca gctttttctc cgtctcccac aacatcgagg aggaagaatt caatgactat gagtccaacg acccttgggt acaacagttc atccttaacc tggagcagca aatggcagag ttcaaggcca gcctgtcccc ggtcatctac gacagcctaa ccggcctcat gactagcctt gttgccgtcg agttggagaa agtggtgctg aaatccacct ttaaccggct gggtggtctg cagtttgaca aggagctgag gtcactcatt gcctacctta ccacggtgac cacctggacc atccgagaca agtttgcccg gctctcccag atggccacca tcctcaatct ggagcgggtg accgagatcc tcgattactg gggacccaat tccggcccat tgacgtggcg cctcacccct gctgaagtgc gccaggtgct ggccctgcgg atagacttcc gcagtgaaga tatcaagagg ctgcgcctgt ag. It is sometimes possible for the material contained within the vial of "COG4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.