CNPY2 cdna clone
CNPY2 cDNA Clone
Gene Names
CNPY2; MSAP; TMEM4; ZSIG9; HP10390
Synonyms
CNPY2; CNPY2 cDNA Clone; CNPY2 cdna clone
Sequence
atgaaaggctggggttggctggccctgcttctgggggccctgctgggaaccgcctgggctcggaggagccaggatctccactgtggagcatgcagggctctggtggatgaactagaatgggaaattgcccaggtggaccccaagaagaccattcagatgggatctttccggatcaatccagatggcagccagtcagtggtggaggtgccttatgcccgctcagaggcccacctcacagagctgctggaggagatatgtgaccggatgaaggagtatggggaacagattgatccttccacccatcgcaagaactacgtacgtgtagtgggccggaatggagaatccagtgaactggacctacaaggcatccgaatcgactcagatattagcggcaccctcaagtttgcgtgtgagagcattgtggaggaatacgaggatgaactcattgaattcttttcccgagaggctgacaatgttaaagacaaactttgcagtaagcgaacagatctttgtgaccatgccctgcacatatcgcatgatgagctatga
Sequence Length
549
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
9,117 Da
NCBI Official Full Name
Homo sapiens canopy 2 homolog (zebrafish), mRNA
NCBI Official Synonym Full Names
canopy FGF signaling regulator 2
NCBI Official Symbol
CNPY2
NCBI Official Synonym Symbols
MSAP; TMEM4; ZSIG9; HP10390
NCBI Protein Information
protein canopy homolog 2
UniProt Protein Name
Protein canopy homolog 2
Protein Family
UniProt Gene Name
CNPY2
UniProt Synonym Gene Names
MSAP; TMEM4; ZSIG9
UniProt Entry Name
CNPY2_HUMAN
Uniprot Description
TMEM4: Positive regulator of neurite outgrowth by stabilizing myosin regulatory light chain (MRLC). It prevents MIR-mediated MRLC ubiquitination and its subsequent proteasomal degradation. Belongs to the canopy family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Secreted, signal peptide; Endoplasmic reticulum; Secreted; Membrane protein, integral
Chromosomal Location of Human Ortholog: 12q15
Cellular Component: endoplasmic reticulum; integral to plasma membrane
Molecular Function: protein binding
Biological Process: enzyme linked receptor protein signaling pathway; positive regulation of low-density lipoprotein receptor biosynthetic process; tissue development
Research Articles on CNPY2
Similar Products
Product Notes
The CNPY2 cnpy2 (Catalog #AAA1268714) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaggct ggggttggct ggccctgctt ctgggggccc tgctgggaac cgcctgggct cggaggagcc aggatctcca ctgtggagca tgcagggctc tggtggatga actagaatgg gaaattgccc aggtggaccc caagaagacc attcagatgg gatctttccg gatcaatcca gatggcagcc agtcagtggt ggaggtgcct tatgcccgct cagaggccca cctcacagag ctgctggagg agatatgtga ccggatgaag gagtatgggg aacagattga tccttccacc catcgcaaga actacgtacg tgtagtgggc cggaatggag aatccagtga actggaccta caaggcatcc gaatcgactc agatattagc ggcaccctca agtttgcgtg tgagagcatt gtggaggaat acgaggatga actcattgaa ttcttttccc gagaggctga caatgttaaa gacaaacttt gcagtaagcg aacagatctt tgtgaccatg ccctgcacat atcgcatgat gagctatga. It is sometimes possible for the material contained within the vial of "CNPY2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
